ID: 1131866276

View in Genome Browser
Species Human (GRCh38)
Location 15:96714099-96714121
Sequence GACATTGCCATAGATTCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131866271_1131866276 11 Left 1131866271 15:96714065-96714087 CCTTGGTTTCTACCTCTCCCATG No data
Right 1131866276 15:96714099-96714121 GACATTGCCATAGATTCAGCTGG No data
1131866273_1131866276 -6 Left 1131866273 15:96714082-96714104 CCCATGCTGCCTTATTTGACATT No data
Right 1131866276 15:96714099-96714121 GACATTGCCATAGATTCAGCTGG No data
1131866270_1131866276 18 Left 1131866270 15:96714058-96714080 CCATGCACCTTGGTTTCTACCTC No data
Right 1131866276 15:96714099-96714121 GACATTGCCATAGATTCAGCTGG No data
1131866272_1131866276 -1 Left 1131866272 15:96714077-96714099 CCTCTCCCATGCTGCCTTATTTG No data
Right 1131866276 15:96714099-96714121 GACATTGCCATAGATTCAGCTGG No data
1131866268_1131866276 30 Left 1131866268 15:96714046-96714068 CCATTTAGAAGGCCATGCACCTT No data
Right 1131866276 15:96714099-96714121 GACATTGCCATAGATTCAGCTGG No data
1131866274_1131866276 -7 Left 1131866274 15:96714083-96714105 CCATGCTGCCTTATTTGACATTG No data
Right 1131866276 15:96714099-96714121 GACATTGCCATAGATTCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131866276 Original CRISPR GACATTGCCATAGATTCAGC TGG Intergenic
No off target data available for this crispr