ID: 1131866277

View in Genome Browser
Species Human (GRCh38)
Location 15:96714100-96714122
Sequence ACATTGCCATAGATTCAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131866270_1131866277 19 Left 1131866270 15:96714058-96714080 CCATGCACCTTGGTTTCTACCTC No data
Right 1131866277 15:96714100-96714122 ACATTGCCATAGATTCAGCTGGG No data
1131866271_1131866277 12 Left 1131866271 15:96714065-96714087 CCTTGGTTTCTACCTCTCCCATG No data
Right 1131866277 15:96714100-96714122 ACATTGCCATAGATTCAGCTGGG No data
1131866274_1131866277 -6 Left 1131866274 15:96714083-96714105 CCATGCTGCCTTATTTGACATTG No data
Right 1131866277 15:96714100-96714122 ACATTGCCATAGATTCAGCTGGG No data
1131866272_1131866277 0 Left 1131866272 15:96714077-96714099 CCTCTCCCATGCTGCCTTATTTG No data
Right 1131866277 15:96714100-96714122 ACATTGCCATAGATTCAGCTGGG No data
1131866273_1131866277 -5 Left 1131866273 15:96714082-96714104 CCCATGCTGCCTTATTTGACATT No data
Right 1131866277 15:96714100-96714122 ACATTGCCATAGATTCAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131866277 Original CRISPR ACATTGCCATAGATTCAGCT GGG Intergenic
No off target data available for this crispr