ID: 1131867807

View in Genome Browser
Species Human (GRCh38)
Location 15:96730710-96730732
Sequence CCAGAGAAGCAGAGGGTAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131867801_1131867807 7 Left 1131867801 15:96730680-96730702 CCTTACACGTGGATTTGAAGACA No data
Right 1131867807 15:96730710-96730732 CCAGAGAAGCAGAGGGTAGAGGG No data
1131867800_1131867807 8 Left 1131867800 15:96730679-96730701 CCCTTACACGTGGATTTGAAGAC No data
Right 1131867807 15:96730710-96730732 CCAGAGAAGCAGAGGGTAGAGGG No data
1131867799_1131867807 11 Left 1131867799 15:96730676-96730698 CCTCCCTTACACGTGGATTTGAA No data
Right 1131867807 15:96730710-96730732 CCAGAGAAGCAGAGGGTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131867807 Original CRISPR CCAGAGAAGCAGAGGGTAGA GGG Intergenic
No off target data available for this crispr