ID: 1131873036

View in Genome Browser
Species Human (GRCh38)
Location 15:96780051-96780073
Sequence CAGGACAGGGGCCAGTTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131873026_1131873036 7 Left 1131873026 15:96780021-96780043 CCTGTTGCCTGTACGGGCTCGGG No data
Right 1131873036 15:96780051-96780073 CAGGACAGGGGCCAGTTGTCAGG No data
1131873024_1131873036 8 Left 1131873024 15:96780020-96780042 CCCTGTTGCCTGTACGGGCTCGG No data
Right 1131873036 15:96780051-96780073 CAGGACAGGGGCCAGTTGTCAGG No data
1131873029_1131873036 0 Left 1131873029 15:96780028-96780050 CCTGTACGGGCTCGGGACTGGCC No data
Right 1131873036 15:96780051-96780073 CAGGACAGGGGCCAGTTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131873036 Original CRISPR CAGGACAGGGGCCAGTTGTC AGG Intergenic
No off target data available for this crispr