ID: 1131877470

View in Genome Browser
Species Human (GRCh38)
Location 15:96825803-96825825
Sequence AAGCAGCAGCAGAAGCAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131877470_1131877476 0 Left 1131877470 15:96825803-96825825 CCATCCTGCTTCTGCTGCTGCTT No data
Right 1131877476 15:96825826-96825848 CTAAGGTGGGGAAAGAAAGCTGG No data
1131877470_1131877478 7 Left 1131877470 15:96825803-96825825 CCATCCTGCTTCTGCTGCTGCTT No data
Right 1131877478 15:96825833-96825855 GGGGAAAGAAAGCTGGAGGCTGG No data
1131877470_1131877480 27 Left 1131877470 15:96825803-96825825 CCATCCTGCTTCTGCTGCTGCTT No data
Right 1131877480 15:96825853-96825875 TGGAGCCAACCGCTGCTGCTGGG No data
1131877470_1131877477 3 Left 1131877470 15:96825803-96825825 CCATCCTGCTTCTGCTGCTGCTT No data
Right 1131877477 15:96825829-96825851 AGGTGGGGAAAGAAAGCTGGAGG No data
1131877470_1131877479 26 Left 1131877470 15:96825803-96825825 CCATCCTGCTTCTGCTGCTGCTT No data
Right 1131877479 15:96825852-96825874 CTGGAGCCAACCGCTGCTGCTGG No data
1131877470_1131877481 28 Left 1131877470 15:96825803-96825825 CCATCCTGCTTCTGCTGCTGCTT No data
Right 1131877481 15:96825854-96825876 GGAGCCAACCGCTGCTGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131877470 Original CRISPR AAGCAGCAGCAGAAGCAGGA TGG (reversed) Intergenic
No off target data available for this crispr