ID: 1131880184

View in Genome Browser
Species Human (GRCh38)
Location 15:96854073-96854095
Sequence TAGGATGAGCATATAGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131880184_1131880189 -9 Left 1131880184 15:96854073-96854095 CCCTCCCCTATATGCTCATCCTA No data
Right 1131880189 15:96854087-96854109 CTCATCCTAAAACACAGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131880184 Original CRISPR TAGGATGAGCATATAGGGGA GGG (reversed) Intergenic
No off target data available for this crispr