ID: 1131880189

View in Genome Browser
Species Human (GRCh38)
Location 15:96854087-96854109
Sequence CTCATCCTAAAACACAGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131880184_1131880189 -9 Left 1131880184 15:96854073-96854095 CCCTCCCCTATATGCTCATCCTA No data
Right 1131880189 15:96854087-96854109 CTCATCCTAAAACACAGAACAGG No data
1131880185_1131880189 -10 Left 1131880185 15:96854074-96854096 CCTCCCCTATATGCTCATCCTAA No data
Right 1131880189 15:96854087-96854109 CTCATCCTAAAACACAGAACAGG No data
1131880182_1131880189 -2 Left 1131880182 15:96854066-96854088 CCTGATCCCCTCCCCTATATGCT No data
Right 1131880189 15:96854087-96854109 CTCATCCTAAAACACAGAACAGG No data
1131880183_1131880189 -8 Left 1131880183 15:96854072-96854094 CCCCTCCCCTATATGCTCATCCT No data
Right 1131880189 15:96854087-96854109 CTCATCCTAAAACACAGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131880189 Original CRISPR CTCATCCTAAAACACAGAAC AGG Intergenic
No off target data available for this crispr