ID: 1131882004

View in Genome Browser
Species Human (GRCh38)
Location 15:96871831-96871853
Sequence CACACGGACGCGCATGAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131882004_1131882009 14 Left 1131882004 15:96871831-96871853 CCATTTTCATGCGCGTCCGTGTG No data
Right 1131882009 15:96871868-96871890 CAGGCTTTGTGTGAGCAACATGG 0: 1153
1: 517
2: 138
3: 64
4: 213
1131882004_1131882006 -5 Left 1131882004 15:96871831-96871853 CCATTTTCATGCGCGTCCGTGTG No data
Right 1131882006 15:96871849-96871871 GTGTGAAGAGACCACCAAACAGG 0: 1170
1: 1149
2: 398
3: 94
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131882004 Original CRISPR CACACGGACGCGCATGAAAA TGG (reversed) Intergenic
No off target data available for this crispr