ID: 1131882006

View in Genome Browser
Species Human (GRCh38)
Location 15:96871849-96871871
Sequence GTGTGAAGAGACCACCAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2941
Summary {0: 1170, 1: 1149, 2: 398, 3: 94, 4: 130}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131882003_1131882006 27 Left 1131882003 15:96871799-96871821 CCTGATACAGGAGGAGTCTGAAT No data
Right 1131882006 15:96871849-96871871 GTGTGAAGAGACCACCAAACAGG 0: 1170
1: 1149
2: 398
3: 94
4: 130
1131882004_1131882006 -5 Left 1131882004 15:96871831-96871853 CCATTTTCATGCGCGTCCGTGTG No data
Right 1131882006 15:96871849-96871871 GTGTGAAGAGACCACCAAACAGG 0: 1170
1: 1149
2: 398
3: 94
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131882006 Original CRISPR GTGTGAAGAGACCACCAAAC AGG Intergenic
Too many off-targets to display for this crispr