ID: 1131882009

View in Genome Browser
Species Human (GRCh38)
Location 15:96871868-96871890
Sequence CAGGCTTTGTGTGAGCAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2085
Summary {0: 1153, 1: 517, 2: 138, 3: 64, 4: 213}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131882004_1131882009 14 Left 1131882004 15:96871831-96871853 CCATTTTCATGCGCGTCCGTGTG No data
Right 1131882009 15:96871868-96871890 CAGGCTTTGTGTGAGCAACATGG 0: 1153
1: 517
2: 138
3: 64
4: 213
1131882005_1131882009 -2 Left 1131882005 15:96871847-96871869 CCGTGTGAAGAGACCACCAAACA 0: 1480
1: 638
2: 165
3: 77
4: 177
Right 1131882009 15:96871868-96871890 CAGGCTTTGTGTGAGCAACATGG 0: 1153
1: 517
2: 138
3: 64
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131882009 Original CRISPR CAGGCTTTGTGTGAGCAACA TGG Intergenic
Too many off-targets to display for this crispr