ID: 1131886173

View in Genome Browser
Species Human (GRCh38)
Location 15:96915590-96915612
Sequence GAATACATTGTTTCTTGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131886173_1131886180 9 Left 1131886173 15:96915590-96915612 CCTCCCCAAGAAACAATGTATTC No data
Right 1131886180 15:96915622-96915644 CCAGCCTTCTCCTTTTGTTTGGG No data
1131886173_1131886178 8 Left 1131886173 15:96915590-96915612 CCTCCCCAAGAAACAATGTATTC No data
Right 1131886178 15:96915621-96915643 GCCAGCCTTCTCCTTTTGTTTGG No data
1131886173_1131886181 10 Left 1131886173 15:96915590-96915612 CCTCCCCAAGAAACAATGTATTC No data
Right 1131886181 15:96915623-96915645 CAGCCTTCTCCTTTTGTTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131886173 Original CRISPR GAATACATTGTTTCTTGGGG AGG (reversed) Intergenic
No off target data available for this crispr