ID: 1131886181

View in Genome Browser
Species Human (GRCh38)
Location 15:96915623-96915645
Sequence CAGCCTTCTCCTTTTGTTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131886172_1131886181 11 Left 1131886172 15:96915589-96915611 CCCTCCCCAAGAAACAATGTATT No data
Right 1131886181 15:96915623-96915645 CAGCCTTCTCCTTTTGTTTGGGG No data
1131886175_1131886181 6 Left 1131886175 15:96915594-96915616 CCCAAGAAACAATGTATTCATAA No data
Right 1131886181 15:96915623-96915645 CAGCCTTCTCCTTTTGTTTGGGG No data
1131886176_1131886181 5 Left 1131886176 15:96915595-96915617 CCAAGAAACAATGTATTCATAAT No data
Right 1131886181 15:96915623-96915645 CAGCCTTCTCCTTTTGTTTGGGG No data
1131886174_1131886181 7 Left 1131886174 15:96915593-96915615 CCCCAAGAAACAATGTATTCATA No data
Right 1131886181 15:96915623-96915645 CAGCCTTCTCCTTTTGTTTGGGG No data
1131886173_1131886181 10 Left 1131886173 15:96915590-96915612 CCTCCCCAAGAAACAATGTATTC No data
Right 1131886181 15:96915623-96915645 CAGCCTTCTCCTTTTGTTTGGGG No data
1131886171_1131886181 12 Left 1131886171 15:96915588-96915610 CCCCTCCCCAAGAAACAATGTAT No data
Right 1131886181 15:96915623-96915645 CAGCCTTCTCCTTTTGTTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131886181 Original CRISPR CAGCCTTCTCCTTTTGTTTG GGG Intergenic
No off target data available for this crispr