ID: 1131887054

View in Genome Browser
Species Human (GRCh38)
Location 15:96927350-96927372
Sequence CCATGTGACCAGGGGGTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131887047_1131887054 2 Left 1131887047 15:96927325-96927347 CCATGAGGAATGGCCAATGGCTT No data
Right 1131887054 15:96927350-96927372 CCATGTGACCAGGGGGTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131887054 Original CRISPR CCATGTGACCAGGGGGTTGA AGG Intergenic
No off target data available for this crispr