ID: 1131887054 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 15:96927350-96927372 |
Sequence | CCATGTGACCAGGGGGTTGA AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1131887047_1131887054 | 2 | Left | 1131887047 | 15:96927325-96927347 | CCATGAGGAATGGCCAATGGCTT | No data | ||
Right | 1131887054 | 15:96927350-96927372 | CCATGTGACCAGGGGGTTGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1131887054 | Original CRISPR | CCATGTGACCAGGGGGTTGA AGG | Intergenic | ||
No off target data available for this crispr |