ID: 1131889958

View in Genome Browser
Species Human (GRCh38)
Location 15:96962396-96962418
Sequence GGGCCCTAGCAAATATACCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131889958_1131889963 8 Left 1131889958 15:96962396-96962418 CCTTGGTATATTTGCTAGGGCCC No data
Right 1131889963 15:96962427-96962449 CAAAGGAAGGAAATGCATGTTGG No data
1131889958_1131889959 -9 Left 1131889958 15:96962396-96962418 CCTTGGTATATTTGCTAGGGCCC No data
Right 1131889959 15:96962410-96962432 CTAGGGCCCAAGTGAATCAAAGG No data
1131889958_1131889960 -5 Left 1131889958 15:96962396-96962418 CCTTGGTATATTTGCTAGGGCCC No data
Right 1131889960 15:96962414-96962436 GGCCCAAGTGAATCAAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131889958 Original CRISPR GGGCCCTAGCAAATATACCA AGG (reversed) Intergenic
No off target data available for this crispr