ID: 1131889959

View in Genome Browser
Species Human (GRCh38)
Location 15:96962410-96962432
Sequence CTAGGGCCCAAGTGAATCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131889958_1131889959 -9 Left 1131889958 15:96962396-96962418 CCTTGGTATATTTGCTAGGGCCC No data
Right 1131889959 15:96962410-96962432 CTAGGGCCCAAGTGAATCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131889959 Original CRISPR CTAGGGCCCAAGTGAATCAA AGG Intergenic
No off target data available for this crispr