ID: 1131889963

View in Genome Browser
Species Human (GRCh38)
Location 15:96962427-96962449
Sequence CAAAGGAAGGAAATGCATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131889958_1131889963 8 Left 1131889958 15:96962396-96962418 CCTTGGTATATTTGCTAGGGCCC No data
Right 1131889963 15:96962427-96962449 CAAAGGAAGGAAATGCATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131889963 Original CRISPR CAAAGGAAGGAAATGCATGT TGG Intergenic
No off target data available for this crispr