ID: 1131894010

View in Genome Browser
Species Human (GRCh38)
Location 15:97006345-97006367
Sequence GCTTTGATGGTACAGTTAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131894010_1131894017 22 Left 1131894010 15:97006345-97006367 CCATCTAACTGTACCATCAAAGC No data
Right 1131894017 15:97006390-97006412 ATGGTCTTTCTACTTGGGTTAGG No data
1131894010_1131894012 3 Left 1131894010 15:97006345-97006367 CCATCTAACTGTACCATCAAAGC No data
Right 1131894012 15:97006371-97006393 AAAAAGCCCTACGTAGATGATGG No data
1131894010_1131894015 16 Left 1131894010 15:97006345-97006367 CCATCTAACTGTACCATCAAAGC No data
Right 1131894015 15:97006384-97006406 TAGATGATGGTCTTTCTACTTGG No data
1131894010_1131894016 17 Left 1131894010 15:97006345-97006367 CCATCTAACTGTACCATCAAAGC No data
Right 1131894016 15:97006385-97006407 AGATGATGGTCTTTCTACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131894010 Original CRISPR GCTTTGATGGTACAGTTAGA TGG (reversed) Intergenic