ID: 1131894011

View in Genome Browser
Species Human (GRCh38)
Location 15:97006358-97006380
Sequence AGGGCTTTTTCTTGCTTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131894011_1131894016 4 Left 1131894011 15:97006358-97006380 CCATCAAAGCAAGAAAAAGCCCT No data
Right 1131894016 15:97006385-97006407 AGATGATGGTCTTTCTACTTGGG No data
1131894011_1131894018 26 Left 1131894011 15:97006358-97006380 CCATCAAAGCAAGAAAAAGCCCT No data
Right 1131894018 15:97006407-97006429 GTTAGGAGAAAAAGTGAACTAGG No data
1131894011_1131894017 9 Left 1131894011 15:97006358-97006380 CCATCAAAGCAAGAAAAAGCCCT No data
Right 1131894017 15:97006390-97006412 ATGGTCTTTCTACTTGGGTTAGG No data
1131894011_1131894015 3 Left 1131894011 15:97006358-97006380 CCATCAAAGCAAGAAAAAGCCCT No data
Right 1131894015 15:97006384-97006406 TAGATGATGGTCTTTCTACTTGG No data
1131894011_1131894012 -10 Left 1131894011 15:97006358-97006380 CCATCAAAGCAAGAAAAAGCCCT No data
Right 1131894012 15:97006371-97006393 AAAAAGCCCTACGTAGATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131894011 Original CRISPR AGGGCTTTTTCTTGCTTTGA TGG (reversed) Intergenic
No off target data available for this crispr