ID: 1131894015

View in Genome Browser
Species Human (GRCh38)
Location 15:97006384-97006406
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131894011_1131894015 3 Left 1131894011 15:97006358-97006380 CCATCAAAGCAAGAAAAAGCCCT No data
Right 1131894015 15:97006384-97006406 TAGATGATGGTCTTTCTACTTGG No data
1131894010_1131894015 16 Left 1131894010 15:97006345-97006367 CCATCTAACTGTACCATCAAAGC No data
Right 1131894015 15:97006384-97006406 TAGATGATGGTCTTTCTACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131894015 Original CRISPR TAGATGATGGTCTTTCTACT TGG Intergenic
No off target data available for this crispr