ID: 1131894016

View in Genome Browser
Species Human (GRCh38)
Location 15:97006385-97006407
Sequence AGATGATGGTCTTTCTACTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131894010_1131894016 17 Left 1131894010 15:97006345-97006367 CCATCTAACTGTACCATCAAAGC No data
Right 1131894016 15:97006385-97006407 AGATGATGGTCTTTCTACTTGGG No data
1131894011_1131894016 4 Left 1131894011 15:97006358-97006380 CCATCAAAGCAAGAAAAAGCCCT No data
Right 1131894016 15:97006385-97006407 AGATGATGGTCTTTCTACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131894016 Original CRISPR AGATGATGGTCTTTCTACTT GGG Intergenic
No off target data available for this crispr