ID: 1131894018

View in Genome Browser
Species Human (GRCh38)
Location 15:97006407-97006429
Sequence GTTAGGAGAAAAAGTGAACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131894013_1131894018 7 Left 1131894013 15:97006377-97006399 CCCTACGTAGATGATGGTCTTTC No data
Right 1131894018 15:97006407-97006429 GTTAGGAGAAAAAGTGAACTAGG No data
1131894011_1131894018 26 Left 1131894011 15:97006358-97006380 CCATCAAAGCAAGAAAAAGCCCT No data
Right 1131894018 15:97006407-97006429 GTTAGGAGAAAAAGTGAACTAGG No data
1131894014_1131894018 6 Left 1131894014 15:97006378-97006400 CCTACGTAGATGATGGTCTTTCT No data
Right 1131894018 15:97006407-97006429 GTTAGGAGAAAAAGTGAACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131894018 Original CRISPR GTTAGGAGAAAAAGTGAACT AGG Intergenic
No off target data available for this crispr