ID: 1131901223

View in Genome Browser
Species Human (GRCh38)
Location 15:97089901-97089923
Sequence GCCCTCACTCCTGGCACCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131901220_1131901223 17 Left 1131901220 15:97089861-97089883 CCAGACTTTAGAGGTCAAGGGGA No data
Right 1131901223 15:97089901-97089923 GCCCTCACTCCTGGCACCAGTGG No data
1131901215_1131901223 29 Left 1131901215 15:97089849-97089871 CCTAGAGTGAGGCCAGACTTTAG No data
Right 1131901223 15:97089901-97089923 GCCCTCACTCCTGGCACCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131901223 Original CRISPR GCCCTCACTCCTGGCACCAG TGG Intergenic
No off target data available for this crispr