ID: 1131902533

View in Genome Browser
Species Human (GRCh38)
Location 15:97104035-97104057
Sequence GGTTATATGTAGAGGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131902528_1131902533 3 Left 1131902528 15:97104009-97104031 CCTTCAGATAACGGGAGTGTGGA No data
Right 1131902533 15:97104035-97104057 GGTTATATGTAGAGGGAAGATGG No data
1131902526_1131902533 4 Left 1131902526 15:97104008-97104030 CCCTTCAGATAACGGGAGTGTGG No data
Right 1131902533 15:97104035-97104057 GGTTATATGTAGAGGGAAGATGG No data
1131902523_1131902533 15 Left 1131902523 15:97103997-97104019 CCAATGTCTTTCCCTTCAGATAA No data
Right 1131902533 15:97104035-97104057 GGTTATATGTAGAGGGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131902533 Original CRISPR GGTTATATGTAGAGGGAAGA TGG Intergenic
No off target data available for this crispr