ID: 1131902980 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 15:97108970-97108992 |
Sequence | AAATATTAGATCAATAAGAC AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1131902976_1131902980 | 15 | Left | 1131902976 | 15:97108932-97108954 | CCACACAATAATAGTGGGAGGTT | 0: 6 1: 168 2: 1832 3: 5740 4: 6628 |
||
Right | 1131902980 | 15:97108970-97108992 | AAATATTAGATCAATAAGACAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1131902980 | Original CRISPR | AAATATTAGATCAATAAGAC AGG | Intergenic | ||
No off target data available for this crispr |