ID: 1131902980

View in Genome Browser
Species Human (GRCh38)
Location 15:97108970-97108992
Sequence AAATATTAGATCAATAAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131902976_1131902980 15 Left 1131902976 15:97108932-97108954 CCACACAATAATAGTGGGAGGTT 0: 6
1: 168
2: 1832
3: 5740
4: 6628
Right 1131902980 15:97108970-97108992 AAATATTAGATCAATAAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131902980 Original CRISPR AAATATTAGATCAATAAGAC AGG Intergenic
No off target data available for this crispr