ID: 1131907082

View in Genome Browser
Species Human (GRCh38)
Location 15:97154548-97154570
Sequence GTAGCAAGTGAAATTGAACC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131907082_1131907085 -4 Left 1131907082 15:97154548-97154570 CCGGGTTCAATTTCACTTGCTAC No data
Right 1131907085 15:97154567-97154589 CTACTCTGTGTACTAAAGGGAGG No data
1131907082_1131907084 -7 Left 1131907082 15:97154548-97154570 CCGGGTTCAATTTCACTTGCTAC No data
Right 1131907084 15:97154564-97154586 TTGCTACTCTGTGTACTAAAGGG No data
1131907082_1131907083 -8 Left 1131907082 15:97154548-97154570 CCGGGTTCAATTTCACTTGCTAC No data
Right 1131907083 15:97154563-97154585 CTTGCTACTCTGTGTACTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131907082 Original CRISPR GTAGCAAGTGAAATTGAACC CGG (reversed) Intergenic
No off target data available for this crispr