ID: 1131909579

View in Genome Browser
Species Human (GRCh38)
Location 15:97182742-97182764
Sequence CAGCGATGGCAGGATTCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131909579_1131909584 8 Left 1131909579 15:97182742-97182764 CCCATGGAATCCTGCCATCGCTG No data
Right 1131909584 15:97182773-97182795 CATATAACACACCGAGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131909579 Original CRISPR CAGCGATGGCAGGATTCCAT GGG (reversed) Intergenic
No off target data available for this crispr