ID: 1131912560

View in Genome Browser
Species Human (GRCh38)
Location 15:97224278-97224300
Sequence TCGCGCTGGCCCGCCAGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131912560_1131912572 4 Left 1131912560 15:97224278-97224300 CCGGCGCTGGCGGGCCAGCGCGA No data
Right 1131912572 15:97224305-97224327 CGGGTGGGCACGGGCTGGGCGGG No data
1131912560_1131912568 -1 Left 1131912560 15:97224278-97224300 CCGGCGCTGGCGGGCCAGCGCGA No data
Right 1131912568 15:97224300-97224322 AGTTCCGGGTGGGCACGGGCTGG No data
1131912560_1131912571 3 Left 1131912560 15:97224278-97224300 CCGGCGCTGGCGGGCCAGCGCGA No data
Right 1131912571 15:97224304-97224326 CCGGGTGGGCACGGGCTGGGCGG No data
1131912560_1131912574 25 Left 1131912560 15:97224278-97224300 CCGGCGCTGGCGGGCCAGCGCGA No data
Right 1131912574 15:97224326-97224348 GGCCCCGCACTTGGAGCCGCTGG No data
1131912560_1131912578 29 Left 1131912560 15:97224278-97224300 CCGGCGCTGGCGGGCCAGCGCGA No data
Right 1131912578 15:97224330-97224352 CCGCACTTGGAGCCGCTGGCCGG No data
1131912560_1131912573 16 Left 1131912560 15:97224278-97224300 CCGGCGCTGGCGGGCCAGCGCGA No data
Right 1131912573 15:97224317-97224339 GGCTGGGCGGGCCCCGCACTTGG No data
1131912560_1131912566 -6 Left 1131912560 15:97224278-97224300 CCGGCGCTGGCGGGCCAGCGCGA No data
Right 1131912566 15:97224295-97224317 GCGCGAGTTCCGGGTGGGCACGG 0: 17
1: 170
2: 372
3: 847
4: 676
1131912560_1131912569 0 Left 1131912560 15:97224278-97224300 CCGGCGCTGGCGGGCCAGCGCGA No data
Right 1131912569 15:97224301-97224323 GTTCCGGGTGGGCACGGGCTGGG No data
1131912560_1131912567 -5 Left 1131912560 15:97224278-97224300 CCGGCGCTGGCGGGCCAGCGCGA No data
Right 1131912567 15:97224296-97224318 CGCGAGTTCCGGGTGGGCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131912560 Original CRISPR TCGCGCTGGCCCGCCAGCGC CGG (reversed) Intergenic
No off target data available for this crispr