ID: 1131912613

View in Genome Browser
Species Human (GRCh38)
Location 15:97224467-97224489
Sequence GTCCCGTGGGTAGGCGGCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131912613_1131912627 29 Left 1131912613 15:97224467-97224489 CCTTAGCCGCCTACCCACGGGAC No data
Right 1131912627 15:97224519-97224541 CAAGCCCCCAGACCCCGCATGGG No data
1131912613_1131912626 28 Left 1131912613 15:97224467-97224489 CCTTAGCCGCCTACCCACGGGAC No data
Right 1131912626 15:97224518-97224540 CCAAGCCCCCAGACCCCGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131912613 Original CRISPR GTCCCGTGGGTAGGCGGCTA AGG (reversed) Intergenic
No off target data available for this crispr