ID: 1131915254

View in Genome Browser
Species Human (GRCh38)
Location 15:97258087-97258109
Sequence CTCTGGACACAAAATCTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131915254_1131915258 9 Left 1131915254 15:97258087-97258109 CCACAGAGATTTTGTGTCCAGAG No data
Right 1131915258 15:97258119-97258141 TGAAGCTGCAGCACTACTAGTGG No data
1131915254_1131915260 13 Left 1131915254 15:97258087-97258109 CCACAGAGATTTTGTGTCCAGAG No data
Right 1131915260 15:97258123-97258145 GCTGCAGCACTACTAGTGGGTGG No data
1131915254_1131915261 16 Left 1131915254 15:97258087-97258109 CCACAGAGATTTTGTGTCCAGAG No data
Right 1131915261 15:97258126-97258148 GCAGCACTACTAGTGGGTGGAGG No data
1131915254_1131915259 10 Left 1131915254 15:97258087-97258109 CCACAGAGATTTTGTGTCCAGAG No data
Right 1131915259 15:97258120-97258142 GAAGCTGCAGCACTACTAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131915254 Original CRISPR CTCTGGACACAAAATCTCTG TGG (reversed) Intergenic
No off target data available for this crispr