ID: 1131918679

View in Genome Browser
Species Human (GRCh38)
Location 15:97300128-97300150
Sequence CCTTCTGTACAAAAGCTACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131918679_1131918681 -5 Left 1131918679 15:97300128-97300150 CCAAGTAGCTTTTGTACAGAAGG No data
Right 1131918681 15:97300146-97300168 GAAGGACTTTAACCTGCAGTTGG No data
1131918679_1131918686 15 Left 1131918679 15:97300128-97300150 CCAAGTAGCTTTTGTACAGAAGG No data
Right 1131918686 15:97300166-97300188 TGGGTCTTCATGCGCCAATGGGG No data
1131918679_1131918688 28 Left 1131918679 15:97300128-97300150 CCAAGTAGCTTTTGTACAGAAGG No data
Right 1131918688 15:97300179-97300201 GCCAATGGGGAAAAGTATGGTGG No data
1131918679_1131918682 -4 Left 1131918679 15:97300128-97300150 CCAAGTAGCTTTTGTACAGAAGG No data
Right 1131918682 15:97300147-97300169 AAGGACTTTAACCTGCAGTTGGG No data
1131918679_1131918684 13 Left 1131918679 15:97300128-97300150 CCAAGTAGCTTTTGTACAGAAGG No data
Right 1131918684 15:97300164-97300186 GTTGGGTCTTCATGCGCCAATGG No data
1131918679_1131918685 14 Left 1131918679 15:97300128-97300150 CCAAGTAGCTTTTGTACAGAAGG No data
Right 1131918685 15:97300165-97300187 TTGGGTCTTCATGCGCCAATGGG No data
1131918679_1131918687 25 Left 1131918679 15:97300128-97300150 CCAAGTAGCTTTTGTACAGAAGG No data
Right 1131918687 15:97300176-97300198 TGCGCCAATGGGGAAAAGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131918679 Original CRISPR CCTTCTGTACAAAAGCTACT TGG (reversed) Intergenic
No off target data available for this crispr