ID: 1131918960

View in Genome Browser
Species Human (GRCh38)
Location 15:97302063-97302085
Sequence CTCCTGGATGGGAAATGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131918953_1131918960 -9 Left 1131918953 15:97302049-97302071 CCTGGTTCCAGCTGCTCCTGGAT No data
Right 1131918960 15:97302063-97302085 CTCCTGGATGGGAAATGGGGTGG No data
1131918945_1131918960 26 Left 1131918945 15:97302014-97302036 CCTGTGAGGACATTTTCTCACAT No data
Right 1131918960 15:97302063-97302085 CTCCTGGATGGGAAATGGGGTGG No data
1131918951_1131918960 -6 Left 1131918951 15:97302046-97302068 CCTCCTGGTTCCAGCTGCTCCTG No data
Right 1131918960 15:97302063-97302085 CTCCTGGATGGGAAATGGGGTGG No data
1131918950_1131918960 -5 Left 1131918950 15:97302045-97302067 CCCTCCTGGTTCCAGCTGCTCCT No data
Right 1131918960 15:97302063-97302085 CTCCTGGATGGGAAATGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131918960 Original CRISPR CTCCTGGATGGGAAATGGGG TGG Intergenic
No off target data available for this crispr