ID: 1131919089

View in Genome Browser
Species Human (GRCh38)
Location 15:97303342-97303364
Sequence CTCCTGGATGGGAAATGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131919089_1131919095 -9 Left 1131919089 15:97303342-97303364 CCACCCCATTTCCCATCCAGGAG No data
Right 1131919095 15:97303356-97303378 ATCCAGGAGCAGCTAGAACCAGG No data
1131919089_1131919100 10 Left 1131919089 15:97303342-97303364 CCACCCCATTTCCCATCCAGGAG No data
Right 1131919100 15:97303375-97303397 CAGGAGGGACTTCCCCATGCAGG No data
1131919089_1131919104 26 Left 1131919089 15:97303342-97303364 CCACCCCATTTCCCATCCAGGAG No data
Right 1131919104 15:97303391-97303413 ATGCAGGAAAATGTCCTCACAGG No data
1131919089_1131919098 -5 Left 1131919089 15:97303342-97303364 CCACCCCATTTCCCATCCAGGAG No data
Right 1131919098 15:97303360-97303382 AGGAGCAGCTAGAACCAGGAGGG No data
1131919089_1131919097 -6 Left 1131919089 15:97303342-97303364 CCACCCCATTTCCCATCCAGGAG No data
Right 1131919097 15:97303359-97303381 CAGGAGCAGCTAGAACCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131919089 Original CRISPR CTCCTGGATGGGAAATGGGG TGG (reversed) Intergenic
No off target data available for this crispr