ID: 1131919579

View in Genome Browser
Species Human (GRCh38)
Location 15:97309628-97309650
Sequence GCCATTTGGCCCCACCTAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131919579_1131919581 -4 Left 1131919579 15:97309628-97309650 CCTCTTAGGTGGGGCCAAATGGC No data
Right 1131919581 15:97309647-97309669 TGGCTAGAGTGAGCTAAAATTGG No data
1131919579_1131919582 -3 Left 1131919579 15:97309628-97309650 CCTCTTAGGTGGGGCCAAATGGC No data
Right 1131919582 15:97309648-97309670 GGCTAGAGTGAGCTAAAATTGGG No data
1131919579_1131919583 18 Left 1131919579 15:97309628-97309650 CCTCTTAGGTGGGGCCAAATGGC No data
Right 1131919583 15:97309669-97309691 GGTATCTTTCTTCCTCCACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131919579 Original CRISPR GCCATTTGGCCCCACCTAAG AGG (reversed) Intergenic
No off target data available for this crispr