ID: 1131924415

View in Genome Browser
Species Human (GRCh38)
Location 15:97366180-97366202
Sequence TATCGTCAGCAGGCTCTGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131924415_1131924423 12 Left 1131924415 15:97366180-97366202 CCCCTCAGAGCCTGCTGACGATA No data
Right 1131924423 15:97366215-97366237 ACCCCTTGATCTTGAACTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131924415 Original CRISPR TATCGTCAGCAGGCTCTGAG GGG (reversed) Intergenic
No off target data available for this crispr