ID: 1131924829

View in Genome Browser
Species Human (GRCh38)
Location 15:97371113-97371135
Sequence CCACCAAGGAACAACCTTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 112}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131924829_1131924834 4 Left 1131924829 15:97371113-97371135 CCATTAAGGTTGTTCCTTGGTGG 0: 1
1: 0
2: 1
3: 11
4: 112
Right 1131924834 15:97371140-97371162 AAATGGTATAAGTAAGTACCAGG 0: 1
1: 0
2: 1
3: 9
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131924829 Original CRISPR CCACCAAGGAACAACCTTAA TGG (reversed) Intergenic
904713359 1:32448147-32448169 CCACCAAGGAAATACTTTACTGG + Intergenic
904916156 1:33972056-33972078 CCAGCCTGGAACATCCTTAAGGG - Intronic
905801289 1:40844786-40844808 CCACCAACAAAAAACCTTAATGG + Intergenic
906507813 1:46393239-46393261 CCACCAAGGAAGTACCTTACCGG + Intergenic
908835901 1:68230087-68230109 CCACCAAGGAGAAGCCCTAAGGG - Intronic
914572455 1:148931721-148931743 TTATCAAAGAACAACCTTAATGG + Intronic
914600384 1:149198541-149198563 TTATCAAAGAACAACCTTAATGG - Intergenic
915577561 1:156790305-156790327 CCTTCTAAGAACAACCTTAAGGG - Intronic
917514621 1:175697474-175697496 ACAGGAAGGAGCAACCTTAAGGG - Intronic
921559396 1:216639272-216639294 CCAAAAAAGAACAAACTTAATGG + Intronic
924494754 1:244576063-244576085 CCACCAAGGAAATACTTTACCGG + Intronic
1063804825 10:9626795-9626817 CCAGTAAGGAAGAATCTTAATGG - Intergenic
1065810499 10:29438581-29438603 CCACCAAGGAAATACTTTACCGG + Intergenic
1068630480 10:59292333-59292355 CCACAAAGAAACAACCATATGGG - Intronic
1070182802 10:74030679-74030701 CCATCAAGGAAAAACATTACTGG - Intronic
1083311615 11:61786643-61786665 CCCCCAGGGAACAGCTTTAAGGG - Exonic
1089389611 11:118091530-118091552 CCACCAAGAAACAAGCTTCTTGG + Intronic
1089859873 11:121579819-121579841 CCACCAATGTACATCCTTCAGGG + Intronic
1093356419 12:18173412-18173434 CCACCAAGGAAGTACTTTACTGG - Intronic
1094141479 12:27186437-27186459 CCACAAGGGACAAACCTTAAGGG + Intergenic
1097176251 12:57145140-57145162 CCACCAGGGAACAGCATTGAGGG - Intronic
1100353205 12:93804265-93804287 CTACCAAGGAACATCCTCACTGG - Intronic
1102348210 12:112172981-112173003 GCACCAAGAAACAACCTGGAAGG - Intronic
1103788176 12:123449274-123449296 CCAACAAGGGACAACTTTATTGG + Intergenic
1113524732 13:110966086-110966108 CCACCAAGGAAATACTTTACCGG - Intergenic
1114236433 14:20827971-20827993 CCACCAAGGAAGTACTTTACCGG + Intergenic
1118498056 14:66328445-66328467 CCACCAAAGAATAACTTTCATGG + Intergenic
1118941118 14:70339213-70339235 CCACCAAGGATCCACAATAATGG - Intronic
1127023396 15:54776015-54776037 CCAAAAAGGAACAACCCTGAGGG + Intergenic
1127689897 15:61385236-61385258 ACTCAAAGGAACAACCTTCATGG - Intergenic
1130966553 15:88701484-88701506 CCACTGAGGACAAACCTTAATGG + Intergenic
1131924829 15:97371113-97371135 CCACCAAGGAACAACCTTAATGG - Intergenic
1131988502 15:98068553-98068575 CCACCAAGCACCAACCCCAAGGG + Intergenic
1132137841 15:99361083-99361105 CCAGCAAGGATGAACTTTAAAGG - Intronic
1133515824 16:6507668-6507690 CCAACATGGATGAACCTTAATGG + Intronic
1135119736 16:19755476-19755498 ACACCTAGAGACAACCTTAAAGG + Intronic
1137039789 16:35599843-35599865 CCACCAAGGAAATACTTTACTGG + Intergenic
1140922390 16:79551167-79551189 CAAGGAAGGGACAACCTTAAAGG + Intergenic
1143707401 17:8708375-8708397 CCAAATAGGAACAACATTAATGG + Intergenic
1148699820 17:49580642-49580664 ACACCAAGGAACACCCTCATTGG - Intronic
1148926626 17:51092007-51092029 CCAACAAGCAACAACCTTTAGGG - Intronic
1149172118 17:53823705-53823727 CCAGCGAGAGACAACCTTAAAGG + Exonic
1152976951 18:230230-230252 TCAACAAGGAACAAACCTAAAGG + Intronic
1155746546 18:29361864-29361886 CCACCAAGGAAGTACTTTACCGG + Intergenic
1160144567 18:76353065-76353087 CCACCAAGGAAACACCTTCCTGG - Intergenic
1161886118 19:6997169-6997191 CCACCATGGCACCACCTTAGTGG - Intergenic
1162268640 19:9596255-9596277 CCACCAAGGAAATACTTTACTGG + Intergenic
1168611489 19:57804263-57804285 CCACCAAGGAAATACTTTACCGG + Intronic
927510196 2:23639613-23639635 CCAGCAAGTAAAAACCTTACTGG - Intronic
930844019 2:55881439-55881461 ATAACAAGAAACAACCTTAAAGG - Intronic
935757341 2:106286616-106286638 TCATCAAGAAACAACATTAAAGG + Intergenic
936112186 2:109674137-109674159 GCATCAAGAAACAACATTAAAGG - Intergenic
937189956 2:120085701-120085723 GCATCAAGGGACAACCGTAAAGG - Intronic
938156975 2:128950068-128950090 CCACCAATGAACAAACACAATGG - Intergenic
942821961 2:180125105-180125127 CCCTCAAAGAACAACTTTAAAGG + Intergenic
945050090 2:205815524-205815546 CCACCATGGAAACACCTTCATGG - Intergenic
946114062 2:217446291-217446313 CCATAAAGGAACAAACATAAAGG - Intronic
947556762 2:231099882-231099904 CCACCAAGGAAATACTTTACCGG + Intronic
948174402 2:235931789-235931811 CCACCAAGCAGAAGCCTTAAAGG + Intronic
1174578403 20:51553798-51553820 CTACCAAGGTAGAACCTCAAGGG + Intronic
1177559386 21:22730365-22730387 TCACCTAGGAACAGCCTAAAAGG + Intergenic
1178130213 21:29563707-29563729 CCATCAGGAAACTACCTTAAGGG + Intronic
1178788376 21:35675410-35675432 CCACACAGGAAGAACCTTAGAGG - Intronic
1179356743 21:40666882-40666904 CAACCAAGGAAGCAACTTAATGG - Intronic
1180906391 22:19415282-19415304 CCAACAATGAACAATCTGAAAGG + Intronic
1185179514 22:49350987-49351009 CCATCACGGATGAACCTTAAGGG + Intergenic
949611540 3:5708207-5708229 CCACCAAGGAAGTACTTTACTGG + Intergenic
950821738 3:15767479-15767501 ACACCAAGCAACAACTTCAAGGG - Intronic
953039888 3:39246517-39246539 CCAACTTGGAACAACTTTAATGG - Intergenic
954107316 3:48416260-48416282 CCACCAAGGAATAACCAGATGGG + Intronic
954604417 3:51897686-51897708 CCACCAAGGAAGTACTTTATCGG - Intronic
963839733 3:150093197-150093219 CCACCAAGGAAAAAGCGTGATGG + Intergenic
964240020 3:154581515-154581537 CCAGCAAGAAACAACCTGAAAGG - Intergenic
966332492 3:178829973-178829995 CCACCGTGTAACCACCTTAAGGG + Intronic
966485959 3:180469719-180469741 CCACCAAAGAACAACTATAAAGG + Intergenic
972604220 4:40599388-40599410 ACACTAAGGATCAACCTAAATGG - Intronic
972784480 4:42314219-42314241 CCACCAAGGAAGTACTTTACCGG - Intergenic
974229760 4:59094682-59094704 CCACTAAGGGGCAACCTTAAAGG + Intergenic
975733038 4:77356224-77356246 CCACCATGGAACAACCATGATGG - Intronic
975736658 4:77388041-77388063 CCACCATGGAACAAGCTGAAGGG - Intronic
982254654 4:153440248-153440270 TCATCAAGGACCAACGTTAAAGG - Intergenic
982661514 4:158212959-158212981 TTACCATGAAACAACCTTAATGG - Intronic
983075750 4:163324281-163324303 ACACCAAGGTACAATGTTAAAGG - Exonic
984715610 4:182921958-182921980 TCACCAAGGAACCTCCTAAAGGG + Intergenic
985142631 4:186858118-186858140 CCTCCTAGAAACAACCTAAAGGG + Intergenic
985471907 5:51782-51804 CCACCCAGGGACAACTTGAACGG - Intergenic
988733509 5:33997127-33997149 CCAAAATGGATCAACCTTAAAGG - Intronic
989615832 5:43335852-43335874 CCACCAAGGAAATACTTTACCGG + Intergenic
994489515 5:100423730-100423752 CTAACAAAGAACAACCTGAAAGG + Intergenic
997065469 5:130554368-130554390 GCACCAAGGAAAAAAATTAAGGG - Intergenic
998853498 5:146373189-146373211 TCAGCATGGAATAACCTTAAAGG + Intergenic
998939053 5:147260924-147260946 CCACCAAGGAAGCACTTTACCGG + Intronic
1005057348 6:21742495-21742517 CTTCCAAGGAAGAACCTAAATGG + Intergenic
1010981248 6:82372509-82372531 CCCTCAAGGATCTACCTTAAGGG - Intergenic
1011450226 6:87484044-87484066 CCACCAAGGAAGTACTTTACTGG + Intronic
1014110567 6:117616117-117616139 CCACCAAGGAAATACTTTACTGG - Intergenic
1017443463 6:154486098-154486120 CCACAAAGGCACACCCTTGAAGG - Intronic
1017495063 6:154976487-154976509 CAAACAAGGAACAACCCAAATGG + Intronic
1019609793 7:1930636-1930658 CCCCCAAGGAACAAGGTGAAGGG - Intronic
1020372961 7:7454590-7454612 CCACCAAGGAACAGCATTAAAGG + Intronic
1021560212 7:21961998-21962020 CTACCATGAAACAACATTAATGG + Intergenic
1021587888 7:22229097-22229119 CCACTAAGGAACATCCCTTAAGG + Intronic
1023335268 7:39162608-39162630 CCACCAAGGAACACACTTTGGGG - Intronic
1024292683 7:47816298-47816320 CCACCAAGGAACTGATTTAAGGG + Intronic
1028338281 7:89685372-89685394 AAACAAAGGAACAACTTTAATGG - Intergenic
1028910151 7:96198844-96198866 CCACAAAGGAAAATACTTAAGGG + Intronic
1038025317 8:23583294-23583316 CCACCAAGAATGAACCCTAATGG - Intergenic
1038264693 8:26029490-26029512 TCACCAAGGAAGAAGCTTAAGGG + Intronic
1040621217 8:49095295-49095317 CCACCAAGGAAGTACTTTAATGG - Intergenic
1042421666 8:68597649-68597671 CGACCAAGGAAGAACCCCAAAGG + Intronic
1042928269 8:73988896-73988918 CCACCCATGAACACCCTTAGTGG - Intergenic
1046721343 8:117622678-117622700 CCTCCAAAGAACAAAATTAAGGG + Intergenic
1052214288 9:25946603-25946625 CCAACAATGAACAACGTGAAAGG - Intergenic
1052286397 9:26790617-26790639 TCACTAAGGAACAACCCTACAGG + Intergenic
1052890431 9:33694416-33694438 TCACCTAGGAACACCCTAAAGGG + Intergenic
1053111208 9:35461330-35461352 CCACCAAGGAAGTACTTTACGGG + Intergenic
1055673742 9:78633717-78633739 ACACCAAAGTAGAACCTTAAAGG - Intergenic
1060439327 9:123624283-123624305 CCACCAAGGATTAAACTCAATGG + Intronic
1189834494 X:45006042-45006064 CCACCAAGGAAATACTTTACCGG + Intronic
1190157979 X:48008972-48008994 CCAACACTGAACAACTTTAACGG - Intronic
1190173750 X:48131856-48131878 CCAACACTGAACAACTTTAACGG - Intronic
1191890247 X:65932185-65932207 CCACCAAGGAAGTACTTTACTGG + Intergenic
1192258796 X:69490534-69490556 CCACCAAGCAACAACCAGAATGG + Intergenic
1194024515 X:88735555-88735577 TCACCAAGGGACAATCTTGATGG + Intergenic
1199278245 X:145971113-145971135 CCACCAAGGAACTACTTCACTGG - Intergenic