ID: 1131928117

View in Genome Browser
Species Human (GRCh38)
Location 15:97408496-97408518
Sequence CGCAGGAAGGGGAAGTGGTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131928108_1131928117 30 Left 1131928108 15:97408443-97408465 CCATCTGACGTGGAATCCAGCAT No data
Right 1131928117 15:97408496-97408518 CGCAGGAAGGGGAAGTGGTCCGG No data
1131928110_1131928117 14 Left 1131928110 15:97408459-97408481 CCAGCATGCAGAAGGCACTCAAT No data
Right 1131928117 15:97408496-97408518 CGCAGGAAGGGGAAGTGGTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131928117 Original CRISPR CGCAGGAAGGGGAAGTGGTC CGG Intergenic
No off target data available for this crispr