ID: 1131928208

View in Genome Browser
Species Human (GRCh38)
Location 15:97409935-97409957
Sequence GTGGAACAGCACCTAAACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131928208_1131928215 30 Left 1131928208 15:97409935-97409957 CCAGTGTTTAGGTGCTGTTCCAC No data
Right 1131928215 15:97409988-97410010 CACTTATAAAAAAGACTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131928208 Original CRISPR GTGGAACAGCACCTAAACAC TGG (reversed) Intergenic
No off target data available for this crispr