ID: 1131929930

View in Genome Browser
Species Human (GRCh38)
Location 15:97430570-97430592
Sequence ATCAGATCCCAGAAGTATTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131929930_1131929933 -3 Left 1131929930 15:97430570-97430592 CCCTAATACTTCTGGGATCTGAT No data
Right 1131929933 15:97430590-97430612 GATTGGCTCAGATTTAAGTTAGG No data
1131929930_1131929934 5 Left 1131929930 15:97430570-97430592 CCCTAATACTTCTGGGATCTGAT No data
Right 1131929934 15:97430598-97430620 CAGATTTAAGTTAGGTGTCTAGG No data
1131929930_1131929935 26 Left 1131929930 15:97430570-97430592 CCCTAATACTTCTGGGATCTGAT No data
Right 1131929935 15:97430619-97430641 GGTGTCTACCCAAATTTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131929930 Original CRISPR ATCAGATCCCAGAAGTATTA GGG (reversed) Intergenic
No off target data available for this crispr