ID: 1131933864

View in Genome Browser
Species Human (GRCh38)
Location 15:97479369-97479391
Sequence TTGAATAAGAATGGTGAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131933861_1131933864 11 Left 1131933861 15:97479335-97479357 CCTGATTGCTCTGGCTAGGATGT No data
Right 1131933864 15:97479369-97479391 TTGAATAAGAATGGTGAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131933864 Original CRISPR TTGAATAAGAATGGTGAGAA TGG Intergenic
No off target data available for this crispr