ID: 1131940485

View in Genome Browser
Species Human (GRCh38)
Location 15:97559601-97559623
Sequence CAGAAGATGTAGAAGTGGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131940485_1131940490 6 Left 1131940485 15:97559601-97559623 CCATACCACTTCTACATCTTCTG No data
Right 1131940490 15:97559630-97559652 AAGGACCCACTATTCTTTTCAGG No data
1131940485_1131940493 30 Left 1131940485 15:97559601-97559623 CCATACCACTTCTACATCTTCTG No data
Right 1131940493 15:97559654-97559676 AATGTATTTGACTTTTACTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131940485 Original CRISPR CAGAAGATGTAGAAGTGGTA TGG (reversed) Intergenic
No off target data available for this crispr