ID: 1131940485 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 15:97559601-97559623 |
| Sequence | CAGAAGATGTAGAAGTGGTA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1131940485_1131940490 | 6 | Left | 1131940485 | 15:97559601-97559623 | CCATACCACTTCTACATCTTCTG | No data | ||
| Right | 1131940490 | 15:97559630-97559652 | AAGGACCCACTATTCTTTTCAGG | No data | ||||
| 1131940485_1131940493 | 30 | Left | 1131940485 | 15:97559601-97559623 | CCATACCACTTCTACATCTTCTG | No data | ||
| Right | 1131940493 | 15:97559654-97559676 | AATGTATTTGACTTTTACTTCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1131940485 | Original CRISPR | CAGAAGATGTAGAAGTGGTA TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||