ID: 1131942589

View in Genome Browser
Species Human (GRCh38)
Location 15:97583923-97583945
Sequence TCTTCAGGTTGATCTTCTCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131942587_1131942589 2 Left 1131942587 15:97583898-97583920 CCTTGGAGAATCTCATGATTATG 0: 6
1: 452
2: 1087
3: 1347
4: 2024
Right 1131942589 15:97583923-97583945 TCTTCAGGTTGATCTTCTCGTGG No data
1131942586_1131942589 14 Left 1131942586 15:97583886-97583908 CCTTAATTTCGACCTTGGAGAAT No data
Right 1131942589 15:97583923-97583945 TCTTCAGGTTGATCTTCTCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131942589 Original CRISPR TCTTCAGGTTGATCTTCTCG TGG Intergenic
No off target data available for this crispr