ID: 1131946382

View in Genome Browser
Species Human (GRCh38)
Location 15:97626750-97626772
Sequence TGGAGTAAGTGCAGCCCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131946374_1131946382 4 Left 1131946374 15:97626723-97626745 CCCTGTAGCACAAACCCCCTTCC No data
Right 1131946382 15:97626750-97626772 TGGAGTAAGTGCAGCCCCTGTGG No data
1131946373_1131946382 15 Left 1131946373 15:97626712-97626734 CCATCTGGTCACCCTGTAGCACA No data
Right 1131946382 15:97626750-97626772 TGGAGTAAGTGCAGCCCCTGTGG No data
1131946375_1131946382 3 Left 1131946375 15:97626724-97626746 CCTGTAGCACAAACCCCCTTCCT No data
Right 1131946382 15:97626750-97626772 TGGAGTAAGTGCAGCCCCTGTGG No data
1131946372_1131946382 19 Left 1131946372 15:97626708-97626730 CCTTCCATCTGGTCACCCTGTAG No data
Right 1131946382 15:97626750-97626772 TGGAGTAAGTGCAGCCCCTGTGG No data
1131946377_1131946382 -10 Left 1131946377 15:97626737-97626759 CCCCCTTCCTCTATGGAGTAAGT No data
Right 1131946382 15:97626750-97626772 TGGAGTAAGTGCAGCCCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131946382 Original CRISPR TGGAGTAAGTGCAGCCCCTG TGG Intergenic
No off target data available for this crispr