ID: 1131953473

View in Genome Browser
Species Human (GRCh38)
Location 15:97706281-97706303
Sequence GGTCCCAAAGGATCACATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131953464_1131953473 27 Left 1131953464 15:97706231-97706253 CCAAAGGAACAGTCACAGGTCAA No data
Right 1131953473 15:97706281-97706303 GGTCCCAAAGGATCACATGGTGG No data
1131953463_1131953473 28 Left 1131953463 15:97706230-97706252 CCCAAAGGAACAGTCACAGGTCA No data
Right 1131953473 15:97706281-97706303 GGTCCCAAAGGATCACATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131953473 Original CRISPR GGTCCCAAAGGATCACATGG TGG Intergenic
No off target data available for this crispr