ID: 1131956782

View in Genome Browser
Species Human (GRCh38)
Location 15:97744726-97744748
Sequence TACTGAGTGCTTCAATATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131956781_1131956782 0 Left 1131956781 15:97744703-97744725 CCAAAAAAGAAAATGATTTATTT No data
Right 1131956782 15:97744726-97744748 TACTGAGTGCTTCAATATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131956782 Original CRISPR TACTGAGTGCTTCAATATTC TGG Intergenic
No off target data available for this crispr