ID: 1131962592

View in Genome Browser
Species Human (GRCh38)
Location 15:97805177-97805199
Sequence TGGCTGCCTGGTTGTAAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131962584_1131962592 10 Left 1131962584 15:97805144-97805166 CCTGCCTCTCTGGAAACAAGGAC No data
Right 1131962592 15:97805177-97805199 TGGCTGCCTGGTTGTAAGGGAGG No data
1131962585_1131962592 6 Left 1131962585 15:97805148-97805170 CCTCTCTGGAAACAAGGACATAC No data
Right 1131962592 15:97805177-97805199 TGGCTGCCTGGTTGTAAGGGAGG No data
1131962581_1131962592 25 Left 1131962581 15:97805129-97805151 CCTTCTTCTCTTTGTCCTGCCTC No data
Right 1131962592 15:97805177-97805199 TGGCTGCCTGGTTGTAAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131962592 Original CRISPR TGGCTGCCTGGTTGTAAGGG AGG Intergenic
No off target data available for this crispr