ID: 1131970770

View in Genome Browser
Species Human (GRCh38)
Location 15:97890556-97890578
Sequence CTGAATATACAAACAGACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 632
Summary {0: 2, 1: 11, 2: 50, 3: 115, 4: 454}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131970770 Original CRISPR CTGAATATACAAACAGACAA TGG (reversed) Intergenic
900879475 1:5370364-5370386 CTGAATATGCAAACAAACAATGG + Intergenic
901823220 1:11843681-11843703 CTGAAGGGAGAAACAGACAACGG - Intergenic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
904881363 1:33699736-33699758 CTGAATCTACTAAAAGACATTGG - Intronic
906172000 1:43734133-43734155 CTGAGTAAATAAAGAGACAAAGG - Intronic
906189633 1:43888489-43888511 ATAAATAAACAAACAAACAAGGG + Intronic
906337819 1:44949404-44949426 CTGAATATACAAAGATAAAAGGG - Intronic
906435294 1:45790590-45790612 GTGTATATACACACACACAATGG + Intronic
907242222 1:53087214-53087236 CTGAATTTGCAAACACAGAAAGG + Exonic
907346658 1:53787346-53787368 CTGAATATAAAAAGAAATAAAGG + Intronic
907536146 1:55160026-55160048 CTGAATATAAACACAGACCATGG + Intronic
908244285 1:62215393-62215415 CTCAATATACAAACATACAATGG - Intergenic
909021994 1:70441711-70441733 CTGAATATAGAAATGGACAGTGG - Intergenic
909040399 1:70642727-70642749 GTGAATCCACAAACAGAAAATGG + Intergenic
909289659 1:73866402-73866424 CTGAAAATACAAAAATTCAATGG + Intergenic
909675145 1:78231137-78231159 CTGAATATAGAAGCAGACATAGG + Intergenic
909959139 1:81817124-81817146 CAGAATAGAAAAACAGACACTGG - Intronic
910270372 1:85387629-85387651 CTCAAAAGACAAAAAGACAAGGG - Intronic
911091869 1:94023585-94023607 CTGAATACACATGCAGAGAAAGG + Intronic
911409866 1:97489439-97489461 CTAAATACACACACATACAAAGG + Intronic
912269011 1:108190558-108190580 CTAAATATACGAAGAGATAATGG - Intronic
912656863 1:111494002-111494024 CTGAATATACAAGTGGACTATGG + Intronic
913119990 1:115731091-115731113 CAGAATATTTAAAGAGACAAAGG - Intronic
913665922 1:121048845-121048867 CAGAATATACAATCGAACAATGG + Intergenic
914017320 1:143832121-143832143 CAGAATATACAATCGAACAATGG + Intergenic
914655931 1:149740653-149740675 CAGAATATACAATCGAACAATGG + Intergenic
914750393 1:150531162-150531184 CTGATTATACAAATGAACAATGG + Intergenic
916389364 1:164314236-164314258 CTGAATATATAAAAAGGAAAGGG - Intergenic
916477244 1:165181982-165182004 CAGGATATATAAATAGACAAAGG + Intergenic
916715935 1:167446688-167446710 TTGAAGATAAAAACAGATAATGG + Intronic
917078768 1:171235311-171235333 CTGAATATACAAAGGGCCACAGG - Intergenic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
917818337 1:178734034-178734056 CTCAATTTAAAAACAGGCAAAGG + Intronic
917942917 1:179941144-179941166 ATGTATATACAAATAGACTATGG + Intergenic
918657235 1:187043308-187043330 CTGAATATATAAATGGACAATGG + Intergenic
918868595 1:189936213-189936235 TTGAATATACATACTGATAATGG - Intergenic
918888468 1:190229858-190229880 ATGAACATATAAAAAGACAAGGG + Intronic
919102214 1:193108744-193108766 CTGAATATATAAATGGATAATGG - Intergenic
919126061 1:193395304-193395326 CTGAATATGGAAACAGACAATGG + Intergenic
920552240 1:206872294-206872316 CTGAATATACAAACAGACAGTGG + Intergenic
921371820 1:214431474-214431496 CTGAACATACAAAGAGTGAATGG + Intronic
922369371 1:224893858-224893880 CTGAATAGGAAAATAGACAATGG - Intergenic
922369836 1:224898273-224898295 CTGAATAGACAAATGGACAATGG - Intronic
923063773 1:230499808-230499830 GTGAATATACTAAAAGTCAATGG - Intergenic
923200351 1:231705036-231705058 CTTAAAATACAGACAGACCAAGG + Intronic
923504242 1:234591770-234591792 CTGAATATAGAAACAGAAGGAGG - Intergenic
924049035 1:240061787-240061809 CAGAATAAACAAACAGACAATGG + Intronic
924177155 1:241402910-241402932 ATGAAAATGCAAACAGAGAAAGG - Intergenic
924272033 1:242343919-242343941 CTGAATAAACAAATGGACAATGG + Intronic
1063033525 10:2261079-2261101 TTGAATATATAAACAAACAATGG - Intergenic
1063057266 10:2519441-2519463 CCTAATATCCAAACATACAAGGG + Intergenic
1063263494 10:4417704-4417726 CAAAATATACAAACATGCAAAGG - Intergenic
1063882234 10:10542942-10542964 CTGAAAATACAGACTGACAATGG - Intergenic
1064432871 10:15286278-15286300 CTAAACAAACAAACAAACAAAGG - Intronic
1065480310 10:26186633-26186655 CTGAATTTACTAGCAGATAAGGG - Intronic
1065870127 10:29949179-29949201 CTGAAAATCAAAACAGCCAAGGG - Intergenic
1065979842 10:30882476-30882498 TGGAATATATAAACATACAATGG + Intronic
1066618043 10:37315849-37315871 ATGAATAGAAAAACAGAGAAAGG - Intronic
1066712636 10:38252211-38252233 CTGAATAAACAAATGGACAATGG - Intergenic
1067071230 10:43133729-43133751 CTGAACATGCAAACAGACAATGG - Intergenic
1067657690 10:48209376-48209398 GTGAATCTACAGACAGACTATGG + Intronic
1067976031 10:51026043-51026065 GTGAATATAAAAACAGAGATTGG + Intronic
1068442327 10:57073982-57074004 CTGAAGTTAAAAACATACAATGG - Intergenic
1068675170 10:59763040-59763062 CTGAATATACAAACAGACAGTGG - Intergenic
1069027092 10:63554342-63554364 CTTAGTATACAATCAGAAAATGG + Intronic
1069144727 10:64876600-64876622 CTGAATATACAAATGGGCAATGG + Intergenic
1069269708 10:66510865-66510887 CTGATAATAAAACCAGACAAGGG - Intronic
1070612021 10:77939899-77939921 CTGAACATACAAATGGGCAATGG + Intergenic
1071136738 10:82462352-82462374 ATTAATATACAAACAAATAAAGG - Intronic
1071352077 10:84756690-84756712 TTGAATATATAAATAGACAAGGG + Intergenic
1071928534 10:90439117-90439139 CTGAACCTAGAAACAGAAAATGG + Intergenic
1072106712 10:92281209-92281231 CCCAATTTAAAAACAGACAAAGG - Intronic
1072186183 10:93041377-93041399 ATAAATAAACAAACAAACAAGGG - Intronic
1072521939 10:96236865-96236887 ATGAGTAGACATACAGACAAAGG - Intronic
1073522486 10:104146672-104146694 CTGGATATACATGCAAACAAGGG + Intronic
1073860952 10:107739486-107739508 GTGTATATACATACATACAATGG + Intergenic
1073863653 10:107775646-107775668 CTGAACATAGGAACAGGCAAAGG + Intergenic
1074687514 10:115974154-115974176 CCGAATATACAAATGGACAGTGG + Intergenic
1075000379 10:118792565-118792587 CTGAATATACAAATGGACAGTGG + Intergenic
1075145542 10:119879849-119879871 CTGCATATACAAACAGACAATGG - Intronic
1075154076 10:119959477-119959499 CTAAATAAACAAACAAACAAAGG - Intergenic
1076079063 10:127561583-127561605 ATGAATATACAAACGGGCAATGG + Intergenic
1077003652 11:338933-338955 CAGAATATACAAACAAAGGAAGG - Intergenic
1077905416 11:6529153-6529175 GTGAATAGACATACAGAAAAGGG - Intronic
1078528357 11:12117856-12117878 CAGAATAGAGAAACACACAAGGG + Intronic
1080237363 11:30086618-30086640 AAAAATATACAAACAGACAATGG - Intergenic
1080570244 11:33549353-33549375 TTAAATAAACAAACAAACAAAGG - Intronic
1081078180 11:38702516-38702538 TTAAATATACAAATGGACAATGG + Intergenic
1081796658 11:45825208-45825230 CCAAATATACAAACGGACAATGG + Intergenic
1081902424 11:46640316-46640338 CTGAATATACTAACAGACAGTGG - Intronic
1082881594 11:58043387-58043409 ATGAATAGACAAATAGACAAAGG - Intronic
1084316737 11:68349996-68350018 CTGAATGAACTAACAGGCAAAGG - Intronic
1086515133 11:87603071-87603093 CTGAATATACAAATAGACAATGG - Intergenic
1086719613 11:90104346-90104368 ATGAATAAACAAGCAAACAAAGG + Intergenic
1087088374 11:94242840-94242862 CTGAACATAAAAATGGACAATGG + Intergenic
1087095230 11:94311754-94311776 CTGAATCTACAAATGAACAATGG - Intergenic
1087096743 11:94326330-94326352 CTGAATATATAAGTGGACAATGG - Intergenic
1087608182 11:100402945-100402967 TTGAATATACAAATAGGCAATGG + Intergenic
1087991078 11:104745630-104745652 CTGAATTTACAAAGAGAGGAAGG - Intergenic
1088129741 11:106472952-106472974 ATGAATAAACCAACAAACAAAGG + Intergenic
1089151790 11:116370022-116370044 CTGAAACCAAAAACAGACAACGG + Intergenic
1090037716 11:123263282-123263304 CTGGCTATACTAACGGACAATGG - Intergenic
1090496764 11:127220704-127220726 TGCACTATACAAACAGACAATGG + Intergenic
1090544007 11:127741626-127741648 GTGAATAGATAAACAGACTATGG - Intergenic
1092701137 12:11232154-11232176 CTGAATAATCAAACAAATAATGG + Intergenic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1094001946 12:25705196-25705218 CTGAATATTCAAACAGCCAATGG + Intergenic
1094794592 12:33956490-33956512 CTAAATATACAAACCAACAATGG + Intergenic
1095106448 12:38239104-38239126 CTAAATATACAAACCAACAATGG + Intergenic
1095121727 12:38426833-38426855 ACGAATATACAAAAGGACAATGG - Intergenic
1095194195 12:39293842-39293864 CTTAATCTACTAACAGAGAAGGG - Intronic
1095325345 12:40884889-40884911 CTGAATATAAGAAAATACAAAGG - Intronic
1095535273 12:43238557-43238579 CTGAATACACAAACAGATAATGG - Intergenic
1095680936 12:44974674-44974696 CTATATATACATACATACAATGG - Intergenic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1095854263 12:46843245-46843267 TTGCATATAGAAAGAGACAATGG - Intergenic
1095857180 12:46873184-46873206 CTGAATAAACAAATAGATGAAGG + Intergenic
1096252146 12:50040228-50040250 CCGAAGATACACTCAGACAAAGG + Intergenic
1097314211 12:58154831-58154853 CTGAAATAACAAACAGAGAAAGG - Intergenic
1097788034 12:63782736-63782758 CTGAATATTCATTCACACAAAGG - Intronic
1098024952 12:66191474-66191496 ATGAATACACAAAGGGACAATGG - Intronic
1098057204 12:66520619-66520641 CTGGATATACACACAGATAGTGG + Intronic
1098992569 12:77080117-77080139 CTGAATATACAGACAAAAAAAGG - Intergenic
1099479403 12:83147503-83147525 CTGAATCAACAGACAAACAAGGG - Intergenic
1099513522 12:83567612-83567634 GTGAAAACAGAAACAGACAAGGG + Intergenic
1099613266 12:84903651-84903673 CTGACTACAGAAACAGAGAATGG - Intronic
1099768215 12:87018185-87018207 CTAAATATATAAACAAACATTGG + Intergenic
1100132454 12:91512967-91512989 CTTACTATAAAAACAAACAAAGG + Intergenic
1101803278 12:108041468-108041490 CTGAACATACAAATGGACAGTGG + Intergenic
1102293525 12:111720665-111720687 CTGAATATATAAACATAGATAGG - Intronic
1102666159 12:114575060-114575082 GGGAAAATACAAACAGGCAATGG - Intergenic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1104356623 12:128092456-128092478 CTGAATATAAAAATGGACAATGG + Intergenic
1106105888 13:26733260-26733282 CTAAATATACAAGTAGACAATGG + Intergenic
1106202152 13:27548103-27548125 CTGAAAATATAAACTCACAAAGG + Exonic
1106359943 13:29021800-29021822 TTGAATAAACAAAGACACAAGGG + Intronic
1106506178 13:30372376-30372398 TTGAAGATAAAAACAGGCAAAGG + Intergenic
1106866309 13:33967994-33968016 GTGAATTTACAGAAAGACAAAGG + Intergenic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1106881627 13:34138279-34138301 CTGAATATACAAACTGACATTGG + Intergenic
1107033923 13:35881024-35881046 CTGAATATACAGATGAACAATGG + Intronic
1107387208 13:39924978-39925000 AAGAATATACAAATATACAAGGG - Intergenic
1107399080 13:40051112-40051134 CAGAAAATAAAAACAGGCAAAGG - Intergenic
1107778636 13:43875481-43875503 CTGAATATGCAAATGGACAATGG + Intronic
1107993735 13:45840908-45840930 CAGAATATCAAAACAGAAAAAGG - Intronic
1108440514 13:50448461-50448483 CTGAATATACAAATGGATGACGG + Intronic
1108756953 13:53514573-53514595 CTGAATGTACAAACACATCAGGG - Intergenic
1109684462 13:65797717-65797739 CTGATTATACAAATGGACAATGG + Intergenic
1109958777 13:69603683-69603705 CTGAATATACAAATGCACAGTGG - Intergenic
1110336082 13:74331823-74331845 CTGAATATAGAACCAGAATATGG + Intergenic
1110661716 13:78065515-78065537 CCGAATATGCAAACAGACAGTGG + Intergenic
1111601360 13:90479601-90479623 CAGAAAATACAAACACACACTGG - Intergenic
1111815693 13:93149998-93150020 CTGCCTGTACAAACAGACCATGG + Intergenic
1111880146 13:93945727-93945749 CTGAATATACAAATGGGCAGTGG - Intronic
1111986072 13:95068231-95068253 CTGAATATACACACAAAAAGTGG + Intronic
1112159486 13:96853047-96853069 CTGACTATAGGAACAGACAAGGG + Intergenic
1112230442 13:97584192-97584214 CTGAATATCTAAATAGACCATGG - Intergenic
1112586093 13:100720285-100720307 CTGAATATACACATAGACAGTGG + Intergenic
1112863261 13:103861795-103861817 CTGAATATAAAACCAGGAAATGG + Intergenic
1113629858 13:111874758-111874780 CTAAATATACCAATGGACAATGG - Intergenic
1114169308 14:20255807-20255829 CTGAATAAATAAACAGAAAAGGG + Intergenic
1114211352 14:20617795-20617817 ATTACTATACAAACAGACAGTGG - Intergenic
1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG + Intergenic
1115155191 14:30331079-30331101 CTGAATATACAAATGGACAGTGG + Intergenic
1115209228 14:30948430-30948452 CTGGGTATACAAACAACCAAAGG + Intronic
1115537595 14:34387768-34387790 CTGAAAATACATACAGAGAGGGG - Intronic
1116110672 14:40576610-40576632 CTGAACATACAAATGGACTATGG + Intergenic
1116146083 14:41070788-41070810 CTGAATATACAGATAGAAAATGG - Intergenic
1116241104 14:42344164-42344186 CTGAGAATACAGACTGACAAGGG - Intergenic
1117091020 14:52250307-52250329 TTGAATAAACAACCAGACACAGG + Intergenic
1117633633 14:57720307-57720329 CTGAAAACAAAATCAGACAAAGG - Intronic
1117654916 14:57945231-57945253 ATGCATCCACAAACAGACAATGG + Intronic
1118601952 14:67476962-67476984 CTAAAAATACAAAAAAACAATGG + Intronic
1119463293 14:74830514-74830536 CTGATTGTACAACCAAACAATGG - Intronic
1119882225 14:78109718-78109740 TTAAATATACAAACAGAAATAGG - Intergenic
1119946027 14:78695370-78695392 TTGAATCTACAAAAAGAGAAAGG - Intronic
1120290071 14:82556929-82556951 CAGGATATACAAAAAGCCAATGG - Intergenic
1121434453 14:93909985-93910007 CCCAAAGTACAAACAGACAATGG - Intergenic
1122155647 14:99748711-99748733 CTGAATATACTAACAACCACTGG - Intronic
1122759563 14:104012406-104012428 CTGAAAATACAATAACACAAAGG - Intronic
1122946864 14:105015358-105015380 GGGAATATACCAACAAACAATGG + Intronic
1123475545 15:20590244-20590266 CTGTATACACATACAGACATGGG - Intergenic
1123642466 15:22410119-22410141 CTGTATACACATACAGACATGGG + Intergenic
1123828907 15:24113341-24113363 ATGTATAAACAAACAGAAAAGGG - Intergenic
1124157857 15:27243698-27243720 ATGAATATGCAAATAGACAATGG - Intronic
1125006787 15:34825471-34825493 TTGAATATACAAATAAAAAATGG + Intergenic
1125114173 15:36068506-36068528 CTGAATATAATAAAAGAAAAAGG + Intergenic
1125358804 15:38844495-38844517 CAGAGTATACACACAGACACAGG + Intergenic
1126347592 15:47712553-47712575 CTCAAAATTCAAACTGACAAAGG - Intronic
1126553235 15:49955630-49955652 ATGAATAGACAAACAGATAAGGG + Intronic
1126757591 15:51939738-51939760 CTGAAAAGACAAACACACCAAGG - Intronic
1127622520 15:60747722-60747744 CAGAATATGCAAACAGGCCATGG + Intronic
1128346877 15:66859534-66859556 CTAAAAATATTAACAGACAATGG - Intergenic
1128854582 15:70998102-70998124 CTGAAAATAGTAACAGAAAAGGG - Intronic
1129958082 15:79657577-79657599 CTGTATATACAAACAGACAATGG + Intergenic
1131970770 15:97890556-97890578 CTGAATATACAAACAGACAATGG - Intergenic
1133410031 16:5560529-5560551 CAGGAGATTCAAACAGACAAAGG - Intergenic
1134673572 16:16073754-16073776 CTCAAAAAACAAACAAACAAAGG + Intronic
1135492213 16:22919315-22919337 CTGAATGTACCAACGAACAATGG - Intergenic
1135498659 16:22974846-22974868 CTGAATATACAGGTGGACAAAGG + Intergenic
1135995279 16:27243419-27243441 TTGAACATACAAACAGCCAATGG + Intronic
1136607465 16:31346087-31346109 CTGAATATACAAAGGGATAGTGG + Intergenic
1136627088 16:31467898-31467920 ATGAAGATAGAAACAGACACTGG - Intergenic
1137448818 16:48551499-48551521 TTGAATATACATTCAGAAAAGGG + Intronic
1137505358 16:49049577-49049599 TTAAACATACAAACTGACAAAGG - Intergenic
1137851263 16:51747152-51747174 AAAAATAAACAAACAGACAAAGG + Intergenic
1138377239 16:56573066-56573088 GTGAGGATACAAACAGAAAACGG + Intergenic
1138525564 16:57604278-57604300 CTCAAAAAACAAACAAACAAAGG - Intergenic
1138792350 16:59920751-59920773 CTGAACATAAAAACAGGCAATGG - Intergenic
1138847174 16:60580410-60580432 ATGAATATACCAACAGTAAATGG - Intergenic
1140630214 16:76843276-76843298 CTGGATATACAAACAAATTAAGG - Intergenic
1143127048 17:4648982-4649004 CTGACTATACAAAAGGACAATGG - Intergenic
1143742154 17:8962311-8962333 ATGAATGTACAAAAAGACACAGG + Intronic
1143872669 17:9968609-9968631 CTGATTATACTAACAGCCAATGG + Intronic
1143894976 17:10128575-10128597 CTGAAAATGAAAACAGGCAAGGG - Intronic
1144060662 17:11581123-11581145 CTGAATATGCAAGCAGACAATGG + Intergenic
1146516169 17:33491240-33491262 CAGAACACACACACAGACAATGG + Intronic
1146552101 17:33789672-33789694 CTCAATACACACACACACAAAGG - Intronic
1148357168 17:46983173-46983195 CCAAATATGCAAATAGACAATGG - Intronic
1150386888 17:64768723-64768745 CCCAATACACAAACAGGCAAAGG + Intergenic
1150536221 17:66044956-66044978 CTCAATTTAAAAATAGACAAAGG + Intronic
1150769217 17:68027247-68027269 CTTGGTATACAAACATACAATGG + Intergenic
1150976666 17:70095230-70095252 CTGAATATACAAATAAATACTGG + Intronic
1151045124 17:70910909-70910931 CTGAATTAATAAACGGACAAAGG + Intergenic
1152144645 17:78561065-78561087 CTGAATATGCAAACAAGCAGTGG + Intronic
1152681141 17:81668687-81668709 ATAAATAAACAAACAAACAAAGG - Intronic
1153084277 18:1265632-1265654 AGGAGTTTACAAACAGACAATGG - Intergenic
1153171556 18:2321918-2321940 ATGAACAGACAAACAGATAAAGG + Intergenic
1153455540 18:5278033-5278055 CTGGATCTAATAACAGACAAAGG + Intergenic
1153627363 18:7034413-7034435 ATGAATAAACAAACATAAAATGG + Intronic
1153807885 18:8725469-8725491 CTCAATATACAACTATACAAAGG + Intronic
1154128275 18:11713618-11713640 CTGAATATATAAACAGGCAATGG - Intronic
1154475479 18:14750815-14750837 TTGATTATACATACAGACTATGG + Intronic
1154936973 18:21070614-21070636 CTAAAGAAACAAACAAACAATGG + Intronic
1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG + Intergenic
1155854317 18:30813761-30813783 CAGATTATGAAAACAGACAAGGG + Intergenic
1155894275 18:31304022-31304044 AAGAATATCCAAACAGACTATGG - Intergenic
1155991523 18:32283774-32283796 TTTAAGATACAAACAGAAAAGGG + Intronic
1156303126 18:35852917-35852939 CAGACTATACAAGCAGACAATGG - Intergenic
1156575355 18:38308604-38308626 ATGCAAATACAAACAGATAATGG - Intergenic
1157015255 18:43704406-43704428 TTGAATATACGAACAGACAATGG - Intergenic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1158156021 18:54426461-54426483 ATGTATATACACACATACAAAGG + Intergenic
1158161408 18:54488648-54488670 TTGAATATACAGATGGACAATGG - Intergenic
1158276684 18:55776537-55776559 CTCAATAGAAAAACAGGCAAAGG + Intergenic
1158499602 18:57988265-57988287 CTGAATAGCCAAGCAGGCAATGG - Intergenic
1158512468 18:58103120-58103142 CTACATAGACAAATAGACAAAGG - Intronic
1158547772 18:58410590-58410612 CTGAATAAACAGTCAGACACTGG + Intergenic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1159017361 18:63112209-63112231 CTGAATATACAAATGGGCAATGG + Intergenic
1159444253 18:68521339-68521361 CTGAATATTCAGACATATAAAGG + Intergenic
1159638185 18:70831426-70831448 CTGAATACACAAATGGACAATGG + Intergenic
1159771697 18:72553412-72553434 GTAAATATCCCAACAGACAAAGG + Intronic
1159862052 18:73661042-73661064 CTGTACATACAAACAGATGATGG + Intergenic
1160611965 18:80095867-80095889 GTGAATATACAAATGAACAATGG + Exonic
1160613057 18:80104043-80104065 CTGAATGTGCCAACAGACAATGG + Intergenic
1161879113 19:6934935-6934957 CTGGATATACAAATAGACAAGGG - Intronic
1166677990 19:44750963-44750985 CTCAATCTCCAATCAGACAAAGG - Intronic
1168456663 19:56516791-56516813 CTGAAGACACAAACTGAAAATGG + Intronic
1168483583 19:56741482-56741504 CCAAATATACATACAGGCAATGG - Intergenic
925152184 2:1622618-1622640 GTAAATATACAAACATACTACGG - Intergenic
925175959 2:1784071-1784093 ATGAAAATACAAGCGGACAATGG + Intergenic
925392348 2:3504937-3504959 CAGAAAATACAAACATACACAGG - Intronic
925392358 2:3505095-3505117 CTGACAATACAAACATACACAGG - Intronic
925451571 2:3973651-3973673 CTGGATATACAAAGAGACAATGG - Intergenic
925853188 2:8104180-8104202 CTGAAAACACAAACAGGCAACGG + Intergenic
926445111 2:12932143-12932165 ATGAATATATAAACAAAAAAGGG + Intergenic
927091842 2:19718314-19718336 CTGTCTATACACACAGATAATGG - Intergenic
927209761 2:20631861-20631883 CTGAATACACAAAGGGACAATGG + Intronic
927283353 2:21331086-21331108 CTGATTTTACAAATAGAGAATGG + Intergenic
928109838 2:28497698-28497720 GAGAATATACAAATGGACAACGG - Intronic
928159644 2:28910527-28910549 CTCAAAATAAAAACAGACAAAGG - Intronic
928248920 2:29657576-29657598 CTGAATTAACAAACACAAAATGG + Intronic
929011747 2:37451854-37451876 CTGAATATACAAAGGGACAATGG - Intergenic
929924890 2:46199934-46199956 CTCAAAAAACAAACAAACAAAGG + Intergenic
930961094 2:57262642-57262664 TGAAATATACCAACAGACAAAGG + Intergenic
932271024 2:70410050-70410072 CTGGATATATATACACACAAAGG + Intergenic
932561646 2:72877446-72877468 CCCAATATAAAAACAGGCAAAGG - Intergenic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
932907358 2:75768325-75768347 TGAAATATACAACCAGACAATGG + Intergenic
932971587 2:76549776-76549798 CTGAATATACAAACGAACAATGG - Intergenic
933178002 2:79197546-79197568 TTGAATATACAAATGGACAATGG - Intronic
935199683 2:100845417-100845439 CTGAATGTACAAATGGACAATGG - Intronic
935330148 2:101971219-101971241 GTGGATATACAAAAAGACAATGG - Intergenic
935440050 2:103082446-103082468 ATGAACAAACAAACAAACAAAGG + Intergenic
935677981 2:105612347-105612369 CCGAATAAACAAACCCACAAAGG - Intergenic
935684222 2:105669455-105669477 CTGAGCATACAAACAGTCAATGG - Intergenic
935782981 2:106524270-106524292 ATGAATATACAAAGGGACAATGG - Intergenic
935930432 2:108118201-108118223 CTGAATATACATATGAACAAGGG - Intergenic
936250774 2:110866710-110866732 GTGAATACAGAGACAGACAAAGG - Intronic
936292235 2:111235172-111235194 CTGAATTTACAAAAAGCCTAAGG - Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938058926 2:128237295-128237317 ATGAATATACAAACAGACAATGG + Intronic
938171070 2:129077162-129077184 CTGAATATACACATACACAATGG - Intergenic
938265382 2:129924325-129924347 CTAAAAATACAAAAAGAAAACGG + Intergenic
938977843 2:136496166-136496188 CTGAATATACAAATGGACAGTGG - Intergenic
939234302 2:139471080-139471102 CTGAATATACCAATGGACCATGG - Intergenic
939728150 2:145749476-145749498 CTGTATGTTCAAACAAACAAAGG + Intergenic
940178818 2:150908789-150908811 CTGAATATACAAGTGAACAATGG - Intergenic
941636681 2:167942366-167942388 CTGAGTATACAAGCAGATATTGG - Intergenic
941908164 2:170737049-170737071 CTGAATATACATACAGACAATGG + Intergenic
942759447 2:179381155-179381177 CAGAATTTACAAACAGCAAAAGG + Intergenic
943070224 2:183132390-183132412 CTGAAAATACAAAAAAAAAAAGG + Intronic
943719758 2:191191433-191191455 CTAGATATACAAAAGGACAATGG - Intergenic
944189566 2:196987402-196987424 CAGAATATACAAATATAAAAAGG + Intronic
944626737 2:201577520-201577542 CTGTATATACATACATGCAATGG + Intronic
944955949 2:204809342-204809364 CTGAACATAGAAACTGGCAAAGG - Intronic
945567281 2:211416451-211416473 CTGAATATACAAAGGGACAATGG + Intronic
945715208 2:213349680-213349702 TGGAATATACATACATACAAGGG + Intronic
946511626 2:220364022-220364044 CTGGATATACATACACACCATGG + Intergenic
946635348 2:221719016-221719038 CTGCATATACAAGCAGACAATGG + Intergenic
947849146 2:233270970-233270992 CTTAATTTACAAAGAAACAAAGG + Intronic
948326604 2:237126797-237126819 CTGAGAAGACACACAGACAAGGG - Intergenic
948380758 2:237548375-237548397 CTGAAAAGCCAAACAGAGAATGG + Intronic
948676797 2:239601569-239601591 GTGAAAATCCAAACTGACAAAGG - Intergenic
1168731702 20:88210-88232 CAGAATCTACAAACTGTCAATGG - Intronic
1169229032 20:3874792-3874814 CTGAACATACAACTGGACAATGG - Exonic
1169702112 20:8458304-8458326 TGAAATATACAAACGGACAATGG - Intronic
1170359010 20:15524066-15524088 ATGAATGTGCACACAGACAAAGG - Intronic
1170406498 20:16043432-16043454 ATCAGTATACAAATAGACAATGG - Intronic
1170819410 20:19743658-19743680 CTGAATATATAAAGGGACAATGG + Intergenic
1171723354 20:28589616-28589638 CTGAATAGAAAAATGGACAAGGG - Intergenic
1171754702 20:29093468-29093490 CTGAATAGAAAAATGGACAAGGG + Intergenic
1171859988 20:30390330-30390352 CTGAATAGAAAAATGGACAAGGG + Intronic
1173591862 20:44231056-44231078 CTCAAAATAAAAACAAACAAGGG + Intergenic
1173794606 20:45850534-45850556 CTGAATATACAAACAGACAATGG - Intronic
1173965672 20:47110717-47110739 TTGAATAAACAAATAAACAAAGG + Intronic
1174198888 20:48793366-48793388 CTGAATATACCAAAAGCCACTGG + Intronic
1174505397 20:51014558-51014580 CTGAATAAACGAACAAATAAAGG - Intronic
1174714049 20:52737837-52737859 CTAGATAAACAAACAGACAGAGG + Intergenic
1174847521 20:53957498-53957520 CTAAAATAACAAACAGACAATGG + Intronic
1175504788 20:59473953-59473975 CTGAATATACAAATGGACCATGG - Intergenic
1176117167 20:63438106-63438128 TTGAAAATACGGACAGACAATGG - Intronic
1176524285 21:7853688-7853710 CTAAATATACAAATGGACAATGG - Intergenic
1176887960 21:14278834-14278856 CTGACTATAAAAACATAAAATGG + Intergenic
1177556094 21:22690543-22690565 GTGGATATAGAAACAGACAATGG - Intergenic
1177650889 21:23961010-23961032 CTGAATATACAAAGGGACAATGG - Intergenic
1178363785 21:31971515-31971537 GAGAACATACAAACAGAGAAAGG + Intronic
1178658305 21:34483701-34483723 CTAAATATACAAATGGACAATGG - Intergenic
1179010414 21:37552028-37552050 CTGAACATACAAATGGACAATGG + Intergenic
1179483471 21:41693595-41693617 CTGAGTATACAAACAGATGTGGG - Intergenic
1179650809 21:42807359-42807381 CTGAATATACAAATGAACAATGG - Intergenic
1180296907 22:10948273-10948295 CTGAATAGAAAAATGGACAAGGG - Intergenic
1181783442 22:25208958-25208980 CTAAATAAACAAACAAACAAAGG - Intergenic
1183089831 22:35514288-35514310 CTGATCATATAAACTGACAAAGG - Intergenic
949639623 3:6021078-6021100 TTGAATATACAATCAAACATTGG - Intergenic
950470857 3:13185405-13185427 CAGAATAAACAAGTAGACAAAGG - Intergenic
950902522 3:16510912-16510934 CAGAATATACAAACAAACTGTGG + Intronic
951063675 3:18239139-18239161 CTCAATATAAAAATAGCCAAAGG + Intronic
951065799 3:18264121-18264143 CTTAATATACAAAAATACAGAGG + Intronic
951811358 3:26703752-26703774 CTGAATATACAAACGGACAGTGG - Intronic
952674933 3:36017258-36017280 TTGAATATACACCCAGAAAAGGG + Intergenic
953016859 3:39085606-39085628 CTGAATATAAAAACTAACCATGG - Exonic
953097503 3:39792979-39793001 CTGAATTTACAAATGGACAATGG - Intergenic
953375449 3:42424383-42424405 CTGAATATATAAATGGATAATGG - Intergenic
953439213 3:42903859-42903881 TTGAATATACAAATGGGCAATGG + Intronic
953510079 3:43527171-43527193 ATAAATATACAAACAGCCATTGG - Intronic
954896172 3:53976887-53976909 CCGAATATCCAGACAAACAATGG - Intergenic
955895011 3:63689558-63689580 CTGAATATACAAATGAACAATGG - Intergenic
956168827 3:66416896-66416918 CTGACATTACAGACAGACAAGGG - Intronic
956237061 3:67084078-67084100 CTGAAAATACAAATGGACAATGG - Intergenic
956398910 3:68855713-68855735 CTGAGTAGATAAACAGACACAGG + Intronic
956697890 3:71934152-71934174 CTGAATATACAAATAGACCATGG + Intergenic
956914588 3:73857819-73857841 CTGAATATCTTAACAGACCATGG + Intergenic
957682189 3:83451275-83451297 CTGTATATGCAAATAAACAATGG + Intergenic
957903033 3:86521701-86521723 CAGAATATGCAAAAAGACTAGGG - Intergenic
958599859 3:96282400-96282422 CTAAATCTACAAAGAGACTATGG - Intergenic
958947264 3:100377913-100377935 CTGAAAATAAAAACAAACATAGG + Intronic
959050650 3:101521677-101521699 CTGAATATATGAAGAGACAATGG - Intergenic
959087695 3:101868801-101868823 GTAAATATCCAAACAGAAAATGG + Intergenic
959737063 3:109671456-109671478 CTGGATATAAAGACAGACATAGG + Intergenic
960404895 3:117247750-117247772 CTTAATAAACAAATAGATAATGG - Intergenic
960475990 3:118129547-118129569 CTGAATATACACATTGACAGTGG + Intergenic
960943499 3:122950134-122950156 AAGAATATACATACAAACAAGGG + Intronic
961471931 3:127120612-127120634 CTGAATCTACAGGCAAACAATGG - Intergenic
962497319 3:135954262-135954284 CAGAATATATAAGGAGACAAGGG - Intergenic
962497325 3:135954318-135954340 CAGAATATATAAGGAGACAAGGG - Intergenic
964314054 3:155424635-155424657 CTAAATATACAGATGGACAATGG + Intronic
964509938 3:157438714-157438736 ATGAATCTCCAAACAGACATGGG + Intronic
964692749 3:159470339-159470361 CTGTATACACAGACAGTCAAAGG + Intronic
964706114 3:159620464-159620486 CTGGATAAAGAAATAGACAATGG + Intronic
965389860 3:168092115-168092137 CTGCCTATAGATACAGACAATGG + Intronic
965540867 3:169870291-169870313 ATGAATATGCAAAGAGAAAAAGG - Intergenic
965711998 3:171564800-171564822 GTGATGAGACAAACAGACAAAGG - Intergenic
965888522 3:173479356-173479378 CAGAATATATAAACAAACATGGG + Intronic
966056684 3:175701419-175701441 CTGAATATACAAATTGACGATGG - Intronic
966555286 3:181252123-181252145 CTAAACATACAAACAGGCAGAGG - Intergenic
967507821 3:190272989-190273011 CTGAATGTACAAATGAACAATGG - Intergenic
967802500 3:193678778-193678800 ATGAATACACAAGCACACAAAGG - Intronic
968200367 3:196748689-196748711 GTGAATGTACATCCAGACAATGG - Intronic
968247746 3:197170797-197170819 CTGGATATAGGAACAGGCAAAGG - Intronic
969852162 4:9966651-9966673 CTAAATAAACAAACAAACACTGG + Intronic
970287843 4:14538171-14538193 CTTATTATACAGACAGAAAATGG - Intergenic
970316764 4:14835460-14835482 CTGACTATCCAAACAGACAATGG + Intergenic
970505488 4:16725319-16725341 TTGAATATGCCAATAGACAATGG + Intronic
970701159 4:18740553-18740575 CTGCATATATAAACATAGAAAGG + Intergenic
970962799 4:21892495-21892517 CATAATATACATACAGAAAATGG - Intronic
971272455 4:25163343-25163365 CTGACTATACAAATGGACAATGG + Intronic
971299485 4:25430001-25430023 CTGAGTATACAAATGGACAATGG - Intergenic
971411496 4:26377746-26377768 CTTAAAATAAAAACAGAGAAAGG - Intronic
971745295 4:30572196-30572218 GAGAATATACAAACAGACACTGG + Intergenic
973016204 4:45141784-45141806 CTGAATGTTCAAACAAGCAATGG + Intergenic
973128746 4:46622321-46622343 CTGAACACACAAAAATACAAAGG - Intergenic
973587917 4:52410837-52410859 GTGAATATATAAATGGACAATGG - Intergenic
974313625 4:60247350-60247372 CAGAATATACATATAGACCAGGG + Intergenic
975767564 4:77684845-77684867 CCCAATTTAAAAACAGACAAAGG + Intergenic
976020607 4:80620266-80620288 CTTAATATACCAACAAGCAAGGG - Intronic
977113339 4:92988785-92988807 TGGAATAAACAAACTGACAAAGG + Intronic
977137009 4:93317451-93317473 TTTAAAAAACAAACAGACAAGGG + Intronic
977763467 4:100769852-100769874 CCACATATACAAACACACAAAGG - Intronic
977829228 4:101570771-101570793 TTGAATATATCAACAGACAATGG + Intronic
978038100 4:104021791-104021813 TTGAATATATAAACAGACAATGG + Intergenic
978157835 4:105509810-105509832 CTGAATATGAAAACAAATAATGG + Intergenic
979072530 4:116226993-116227015 CTGAATATTCAAATAGCCAAAGG + Intergenic
979896664 4:126166257-126166279 CACAATAAACTAACAGACAAAGG + Intergenic
980303179 4:131020658-131020680 CTTAATATATACACATACAAGGG + Intergenic
980465833 4:133179488-133179510 CAGAATGTATAAACACACAAGGG - Intronic
980556215 4:134409008-134409030 CTGATTATGCAAGCAGACAGAGG - Intergenic
980933859 4:139207666-139207688 CTAAATATATAAACAGAGAGAGG + Intergenic
980946517 4:139325923-139325945 TAGCATATAAAAACAGACAACGG - Intronic
981248894 4:142574785-142574807 CTGTATAAACAAACAAACAAAGG - Intronic
981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG + Intronic
981709309 4:147693140-147693162 CTGAAAATACAAAAAATCAACGG + Intergenic
981887155 4:149690206-149690228 ATGTATATACACACACACAATGG + Intergenic
982852072 4:160331250-160331272 GTGAATATATAAACAAACTATGG + Intergenic
982890619 4:160844764-160844786 GTGAATATTCATACAGATAACGG + Intergenic
983182427 4:164664276-164664298 CTGAAAAGCCAAGCAGACAATGG - Intergenic
983387363 4:167082423-167082445 CTTTATTTACAAACAGACAATGG - Intronic
985644155 5:1077240-1077262 CTGAAGATGCAACCACACAAAGG + Intronic
986058238 5:4161135-4161157 GACAATATACAAACAAACAATGG + Intergenic
986779418 5:11050575-11050597 CTGAATATGCAAATGGACAATGG + Intronic
986904385 5:12476220-12476242 TTGAATATAGAAGTAGACAATGG - Intergenic
987665466 5:20932771-20932793 CTGAATATAACAAAAGACAGAGG + Intergenic
987691667 5:21274847-21274869 CTGAATACACTAACAGACAATGG - Intergenic
988684076 5:33511330-33511352 ATGAATACACAAATAGACAATGG + Intergenic
988757226 5:34269407-34269429 CTGAATATAACAAAAGACAGAGG - Intergenic
989320113 5:40124130-40124152 CAGAACAGACATACAGACAAAGG + Intergenic
990073986 5:51819867-51819889 ATAAATATAAAAAAAGACAATGG - Intergenic
990178162 5:53130200-53130222 ATGAATAAATAAACAAACAAAGG + Intergenic
990288175 5:54321611-54321633 CAGAACATACACACACACAAAGG - Intergenic
990686569 5:58309560-58309582 CCAAATAAACAAACAGAAAAAGG - Intergenic
991137483 5:63199211-63199233 ATGCACATACAAACAAACAATGG - Intergenic
991231137 5:64333674-64333696 CTCAGAATACAAAAAGACAAGGG - Intronic
991748710 5:69775290-69775312 CTGAATACACTAACAGACAATGG + Intergenic
991800288 5:70355102-70355124 CTGAATACACTAACAGACAATGG + Intergenic
991828312 5:70654939-70654961 CTGAATACACTAACAGACAATGG - Intergenic
991892646 5:71354542-71354564 CTGAATACACTAACAGACAATGG + Intergenic
992111848 5:73501864-73501886 TTTAATATAAAAACAGAAAAGGG + Intronic
992756192 5:79908571-79908593 GTGTATATACACACAGACACAGG - Intergenic
993687365 5:90955413-90955435 TTGAATAAACAAACATATAAAGG - Intronic
994540312 5:101086936-101086958 GTGTATATACACACACACAAAGG - Intergenic
994693353 5:103045049-103045071 CTGAAAATAAAACCAGAAAAGGG - Intergenic
995232051 5:109777226-109777248 CTGACAATACAAACTGAGAAAGG - Intronic
995326936 5:110900525-110900547 TTGAATATACAATCAGAAATGGG - Intergenic
995977677 5:118060757-118060779 GTGTATATACATACACACAATGG - Intergenic
996662714 5:126023004-126023026 CTGAATATACAAATGAAAAATGG - Intergenic
996670892 5:126115572-126115594 CTGAATATACAAATGGACAGTGG - Intergenic
997715168 5:136037116-136037138 CTGCATTTACAAAGAGAGAAGGG + Intronic
997810061 5:136958281-136958303 CTAGATATACAAACAGAGAATGG - Intergenic
997866113 5:137464308-137464330 ATAAATAAACAAACAAACAAAGG + Intronic
999054502 5:148559588-148559610 CTAAACATACAAATGGACAATGG + Intronic
999343779 5:150796824-150796846 TTGAATATAGTAACAGAAAAGGG + Intergenic
999424273 5:151473492-151473514 CTGAAGAGAAAAACATACAAAGG + Intronic
999724841 5:154428266-154428288 ATGTATATACAAACACACACAGG - Intergenic
999927543 5:156395587-156395609 CTGAATATACAAATGGATGATGG - Intronic
1001167893 5:169387699-169387721 CTGAAGAAAAAAACAGGCAAAGG - Intergenic
1003322404 6:5063517-5063539 CAGAATAAACAACCACACAAGGG - Intergenic
1003635519 6:7828349-7828371 CTGAACACACAAACAGAACAGGG - Intronic
1003673677 6:8182797-8182819 CTGAAAATACAAATAGACAGAGG - Intergenic
1004166798 6:13264330-13264352 CTGAATATATAAAAAGGGAAAGG - Intronic
1004233028 6:13850032-13850054 CTGAATATATAAACAGATGATGG - Intergenic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1005315825 6:24601942-24601964 CTGGATATAAAAGCAGACAATGG - Intronic
1005583878 6:27257743-27257765 TTGAATATACAAATGGATAATGG - Intergenic
1005801866 6:29433671-29433693 TTGAATATATACACAGACAAGGG + Intronic
1006214245 6:32426125-32426147 CTGGATATAGAAACAGACAATGG + Intergenic
1008193692 6:48492002-48492024 CTGAAAACACAAAGAAACAAGGG - Intergenic
1008281110 6:49597349-49597371 GTGAATAAACAAAAAGAAAAAGG + Intergenic
1008876481 6:56335238-56335260 CTAAATATACAAATGGACAATGG + Intronic
1010336869 6:74695662-74695684 CTGAACAAACAACCAGACACAGG + Intergenic
1010793279 6:80089799-80089821 CTGAATTTAGAATCAGAGAATGG - Intergenic
1011114161 6:83872175-83872197 CTGAATGTGCAAAAAGATAATGG - Intronic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1011954470 6:93008964-93008986 CTGAATATGCAAAGAAGCAATGG + Intergenic
1013462636 6:110389963-110389985 CTGAATGTACAAATGGACAATGG - Intergenic
1013749943 6:113393248-113393270 CTGAGAAGACAAACAGTCAAAGG - Intergenic
1014767264 6:125421307-125421329 CTGAATATATAAATGGACAATGG - Intergenic
1014835727 6:126158356-126158378 CAGAAAATACAAAAGGACAAAGG - Intergenic
1014841875 6:126228916-126228938 TTGAATATCGAAACAGACCATGG - Intergenic
1015833913 6:137398856-137398878 CGGAATTTACAGACAGCCAAGGG - Intergenic
1016061281 6:139633745-139633767 TTGCATAAACAAACAGGCAAAGG + Intergenic
1016573153 6:145537288-145537310 TTGAATATACAAATTGACAATGG - Intronic
1016710542 6:147166348-147166370 CTCAGTATACAAATACACAATGG + Intergenic
1016797956 6:148137970-148137992 CTGTATATGCAAATGGACAATGG - Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017452563 6:154567336-154567358 CTGAATCAACAAACAAACAAGGG + Intergenic
1017989724 6:159475728-159475750 ATGAAGCTACAAACAGAAAATGG + Intergenic
1018082741 6:160272347-160272369 CTGAATATACACATGGACAATGG - Intronic
1018162342 6:161057855-161057877 TTAAACATACAAACATACAAAGG + Intronic
1019870396 7:3755419-3755441 CGGACTATGCAGACAGACAATGG - Intronic
1020830721 7:13091508-13091530 CTGAAGACACAAATAGACAATGG - Intergenic
1021271318 7:18590007-18590029 TTGAACATACAAACAGGAAAAGG - Intronic
1021361564 7:19719384-19719406 GTGTATATACACACACACAATGG - Exonic
1021602386 7:22377434-22377456 CTGGATTTACAACCAGACATGGG + Intergenic
1021792659 7:24221590-24221612 AAGGATATACAAATAGACAATGG + Intergenic
1022344812 7:29504037-29504059 CTGATTATACAAACAGATGCAGG - Intronic
1022592101 7:31673387-31673409 CTGAAAATAGAAACAGACAATGG - Intergenic
1023971584 7:44995207-44995229 CTGAATATACAAATAGACAATGG + Intergenic
1024050198 7:45615631-45615653 CTGAAAATACCTTCAGACAAAGG + Intronic
1024133490 7:46382336-46382358 CATAATAGACAAATAGACAATGG + Intergenic
1024961484 7:54981381-54981403 CTGAGTACACAAATGGACAATGG + Intergenic
1024995305 7:55269656-55269678 CTGAGTACACAAATGGACAATGG + Intergenic
1025029601 7:55546443-55546465 CTGAATCTCCCAACAGAAAAAGG + Intronic
1026632906 7:72053227-72053249 CTCAAAAAACAAACAAACAAAGG + Intronic
1027502949 7:78978283-78978305 CTGAATAGATAAACAAACTATGG + Intronic
1027945492 7:84739743-84739765 CTGTATATATAAACTGAAAATGG + Intergenic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1028956581 7:96700312-96700334 CAGAGTACACAACCAGACAAAGG + Intronic
1029055321 7:97734051-97734073 CTAAAGATCCAAACTGACAAAGG + Intronic
1029209575 7:98895615-98895637 CTCAAGATACAAATAGGCAATGG - Intronic
1030079865 7:105767953-105767975 CTGAATTTAGAAACAAATAAGGG - Intronic
1031159601 7:118150486-118150508 CTGAAAATACAGCCAGGCAATGG + Intergenic
1031164887 7:118216072-118216094 GTGAATGTACAAATAGACAATGG + Intronic
1031209076 7:118798773-118798795 CTAAATATGCAAACAAACAATGG - Intergenic
1031719473 7:125153310-125153332 CAGGATATAGAAACACACAAGGG - Intergenic
1031760635 7:125709118-125709140 CTCACTATACACACATACAATGG - Intergenic
1031788118 7:126060448-126060470 CCGAATACACAAACATAAAAGGG - Intergenic
1031846885 7:126815973-126815995 CTAAACATACAAATACACAAAGG + Intronic
1032112625 7:129089665-129089687 ATGAAAATACAAACAGACAATGG + Intergenic
1032288129 7:130559173-130559195 CTGAATATACAAAAAAATTAAGG + Intronic
1033184328 7:139212836-139212858 ATGAATTTACAAACAAAAAATGG + Intergenic
1033353142 7:140578568-140578590 CTAAATATATATACAGAGAAAGG + Intronic
1033363455 7:140654143-140654165 CTGAATACGCAAAGGGACAATGG - Intronic
1034075095 7:148223947-148223969 CTGAGGATACAAACACACAGAGG - Intronic
1034672263 7:152867682-152867704 CTGAATACACAAATGGACAATGG - Intergenic
1035079368 7:156203399-156203421 TTGAATAGTAAAACAGACAATGG - Intergenic
1035556242 8:569297-569319 CCGAATATGCAAACAGACAAGGG - Intergenic
1035915277 8:3613624-3613646 CAAAATATACAAACAAAAAATGG + Intronic
1036000857 8:4602045-4602067 ATGAATATAGAAATAGATAAAGG + Intronic
1037741137 8:21610149-21610171 CTGCACATACACACAGTCAAAGG + Intergenic
1038627523 8:29208631-29208653 CTGAATATTCAAATAGACAACGG + Intronic
1038664060 8:29522282-29522304 CTGAAAAGACAAACAGCTAAGGG - Intergenic
1038843867 8:31211044-31211066 CTGAATGTACAAATAGACAATGG + Intergenic
1039781372 8:40789442-40789464 CTGAATATGCAAATGGACAATGG + Intronic
1039919730 8:41884835-41884857 ATAAATAAACAAACAAACAAGGG + Intronic
1039927963 8:41955840-41955862 CTGAATATGTAAGCACACAAAGG + Intronic
1040138751 8:43885538-43885560 CAAAATATTAAAACAGACAATGG - Intergenic
1040606417 8:48936507-48936529 CTAAATATACACACTGACCATGG - Intergenic
1040634633 8:49258061-49258083 TTGAATATGCTAACAGATAATGG + Intergenic
1040960995 8:53032646-53032668 TTGAAGATACAAATGGACAATGG - Intergenic
1041338779 8:56819083-56819105 CTGAATAGACAAACAGATTGTGG + Intergenic
1041443914 8:57929437-57929459 CTGAATATACCAATGGATAATGG - Intergenic
1042479709 8:69289721-69289743 CTGAACATACACAAAGAAAATGG - Intergenic
1042884271 8:73530735-73530757 CTGAAAAAACAAAAAGATAAAGG + Intronic
1043218263 8:77622916-77622938 CTGAAAAGACAAAAAGAGAATGG - Intergenic
1043275978 8:78393296-78393318 CTGAATATATAAACTTACATTGG - Intergenic
1043429974 8:80185240-80185262 CTGAATATACAAATGGACATTGG + Intronic
1043775188 8:84258194-84258216 CTGATGAGACAAACAGATAAAGG - Intronic
1043868850 8:85406815-85406837 GTGAATATACTAAAAGACACTGG + Intronic
1044060794 8:87632260-87632282 TTGAATATACATAGAGAGAAAGG + Intergenic
1044240671 8:89884869-89884891 CTGAATATGCAAATGGACAATGG + Intergenic
1044459088 8:92424158-92424180 CTAAATATACCAAGAGAGAATGG + Intergenic
1044605892 8:94047102-94047124 CTGAATATGCAAATGGACAATGG + Intergenic
1044798051 8:95924079-95924101 CAGAATAAAAAATCAGACAAGGG + Intergenic
1044854020 8:96456095-96456117 CTGAATTTACAAACAGGGTAAGG - Intergenic
1045213354 8:100122031-100122053 CTGAATATACAAATGGACAGTGG + Intronic
1046124462 8:109886811-109886833 ATGAATATACAAAGACATAAAGG + Intergenic
1047716689 8:127602237-127602259 ATGAAGATATAAACAGAGAATGG + Intergenic
1047814537 8:128448439-128448461 CTCAATATACCAACTGCCAATGG + Intergenic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1050224419 9:3435364-3435386 CTAAATATACAAAAAGATTACGG - Intronic
1050285433 9:4097018-4097040 ATAAATAAACAAACAAACAAAGG + Intronic
1050483638 9:6111900-6111922 CTGAATATACAAATAAACACTGG + Intergenic
1050712331 9:8479550-8479572 CTAAAAATAAAAACTGACAAAGG + Intronic
1051001814 9:12291157-12291179 CTGAATATACAAACAAACAATGG - Intergenic
1051014454 9:12458720-12458742 CTGAATATACAAATAGACAATGG + Intergenic
1051042969 9:12836813-12836835 CTGAATATACAAATACACTCTGG + Intergenic
1051581419 9:18680211-18680233 CTGATTATACCAATAGACATGGG + Intronic
1052169168 9:25372512-25372534 CTCAAAAAACAAACAAACAAAGG + Intergenic
1052644994 9:31223027-31223049 CTTTATATACAAACACACATAGG + Intergenic
1052810347 9:33052906-33052928 CTTAATATACAAACATCCAGGGG + Intronic
1052946786 9:34174989-34175011 ATGAATACACAAACACAAAAAGG - Intergenic
1053601644 9:39616948-39616970 CTGAATATTAAAACAGACAGTGG + Intergenic
1053649987 9:40157828-40157850 CTGAATGTTCAAACAAGCAATGG - Intergenic
1053726747 9:41010739-41010761 CTGAATAGAAAAATGGACAAGGG + Intergenic
1053755753 9:41306099-41306121 CTGAATGTTCAAACAAGCAATGG + Intergenic
1053859292 9:42370715-42370737 CTGAATATTAAAACAGACAGTGG + Intergenic
1054251891 9:62725498-62725520 CTGAATATTAAAACAGACAGTGG - Intergenic
1054330495 9:63749586-63749608 CTGAATGTTCAAACAAGCAATGG - Intergenic
1054534594 9:66218375-66218397 CTGAATGTTCAAACAAGCAATGG + Intergenic
1054566004 9:66759999-66760021 CTGAATATTAAAACAGACAGTGG - Intergenic
1055699572 9:78928424-78928446 CTGAACATACCAACAAACAATGG + Intergenic
1056520077 9:87393027-87393049 CTGAATACACAAACAGATGATGG + Intergenic
1056602016 9:88053874-88053896 CTGAGTACACAAACAGACAATGG + Intergenic
1056627617 9:88266472-88266494 CTGAAAATGCAAATAGACAATGG + Intergenic
1057665532 9:97042099-97042121 CTGAGTAAACAAATAGACAATGG - Intergenic
1058471879 9:105288117-105288139 CTGATTATACAAATATGCAAAGG - Intronic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1060066082 9:120502442-120502464 CTGAATACACATACATACACTGG - Intronic
1061718477 9:132536722-132536744 CGGAATATCCAAATGGACAATGG - Intronic
1062012618 9:134275180-134275202 CTGAACATGCAAACAGCAAATGG - Intergenic
1202797876 9_KI270719v1_random:142504-142526 CTGAATGTTCAAACAAGCAATGG - Intergenic
1185664770 X:1756951-1756973 GTGAGTATACAAGCAGATAATGG + Intergenic
1186096777 X:6110878-6110900 CTGAATCTGCACACAGACAGAGG + Intronic
1186620366 X:11234438-11234460 CTGGAAATACAAACAAACATTGG - Intronic
1186913696 X:14197090-14197112 CTGAATATAAAATAAAACAAAGG - Intergenic
1188295408 X:28441198-28441220 TTGAATATACAAAGGAACAAGGG - Intergenic
1188339565 X:28982193-28982215 CTGTAAATTCAAACAGGCAATGG - Intronic
1188649713 X:32617058-32617080 CTGAATCCACAGACAGAGAAAGG + Intronic
1189361178 X:40353221-40353243 CTGATAGTACAAACAGACAAAGG + Intergenic
1189623643 X:42871283-42871305 CAGAAAATAAAAACAAACAAAGG - Intergenic
1189786239 X:44560984-44561006 ATAAATAAACAAACAAACAAAGG + Intergenic
1190139419 X:47829267-47829289 CTGAATATACAAACAGGCAATGG - Intergenic
1190748289 X:53339857-53339879 CTGAACGTACAAATTGACAATGG + Intergenic
1191213543 X:57912748-57912770 GTGAATATACAAACAGAGCAAGG - Intergenic
1191739345 X:64420172-64420194 CTGAACATAGAAACTGGCAAAGG - Intergenic
1192988182 X:76422998-76423020 TTGAATGTACAAATGGACAATGG - Intergenic
1193426646 X:81347977-81347999 CTGAATATAGAGACAGACGATGG + Intergenic
1193928368 X:87520063-87520085 CTTAATATACATACAGGAAATGG + Intronic
1194001688 X:88437616-88437638 CTGAATACATAAATGGACAATGG + Intergenic
1194153494 X:90356733-90356755 ATGAATACACACACAGACAAGGG + Intergenic
1194378130 X:93161296-93161318 CAGAACATACAAACAGTCTAAGG + Intergenic
1194484139 X:94466160-94466182 CTGGACATAGAAACAGGCAAAGG + Intergenic
1198805466 X:140490018-140490040 CTGAATAAACATACAGAAAATGG + Intergenic
1199133295 X:144220154-144220176 CTGAAGATAGATAGAGACAAAGG - Intergenic
1199204143 X:145128089-145128111 TCGAATATACAAACAGACAACGG + Intergenic
1199212516 X:145230205-145230227 ATGTATAAAAAAACAGACAAAGG + Intergenic
1199431606 X:147767375-147767397 CTTAATATACAAACAGGCACAGG - Intergenic
1200499830 Y:3933529-3933551 ATGAATACACACACAGACAACGG + Intergenic
1200781479 Y:7220248-7220270 CTGAAAATATAAACAGACAATGG + Intergenic
1201315650 Y:12643070-12643092 CTGAATATACAAATGGACATTGG + Intergenic