ID: 1131972850

View in Genome Browser
Species Human (GRCh38)
Location 15:97909485-97909507
Sequence CGTGTTAGGCTGCCCTCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131972850_1131972862 30 Left 1131972850 15:97909485-97909507 CCATGAGAGGGCAGCCTAACACG No data
Right 1131972862 15:97909538-97909560 TGAGAGGTATAGATGGCCTAGGG No data
1131972850_1131972858 6 Left 1131972850 15:97909485-97909507 CCATGAGAGGGCAGCCTAACACG No data
Right 1131972858 15:97909514-97909536 GTAGGAATCGGGGCTGCTCAAGG No data
1131972850_1131972861 29 Left 1131972850 15:97909485-97909507 CCATGAGAGGGCAGCCTAACACG No data
Right 1131972861 15:97909537-97909559 CTGAGAGGTATAGATGGCCTAGG No data
1131972850_1131972854 -6 Left 1131972850 15:97909485-97909507 CCATGAGAGGGCAGCCTAACACG No data
Right 1131972854 15:97909502-97909524 AACACGGTTCCTGTAGGAATCGG No data
1131972850_1131972855 -5 Left 1131972850 15:97909485-97909507 CCATGAGAGGGCAGCCTAACACG No data
Right 1131972855 15:97909503-97909525 ACACGGTTCCTGTAGGAATCGGG No data
1131972850_1131972859 14 Left 1131972850 15:97909485-97909507 CCATGAGAGGGCAGCCTAACACG No data
Right 1131972859 15:97909522-97909544 CGGGGCTGCTCAAGGCTGAGAGG No data
1131972850_1131972860 23 Left 1131972850 15:97909485-97909507 CCATGAGAGGGCAGCCTAACACG No data
Right 1131972860 15:97909531-97909553 TCAAGGCTGAGAGGTATAGATGG No data
1131972850_1131972856 -4 Left 1131972850 15:97909485-97909507 CCATGAGAGGGCAGCCTAACACG No data
Right 1131972856 15:97909504-97909526 CACGGTTCCTGTAGGAATCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131972850 Original CRISPR CGTGTTAGGCTGCCCTCTCA TGG (reversed) Intergenic
No off target data available for this crispr