ID: 1131974432

View in Genome Browser
Species Human (GRCh38)
Location 15:97929970-97929992
Sequence CTGGGTAGGACTGAAACTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131974427_1131974432 4 Left 1131974427 15:97929943-97929965 CCAGCTTTAGATCTCCAGGCTCA No data
Right 1131974432 15:97929970-97929992 CTGGGTAGGACTGAAACTGCAGG No data
1131974431_1131974432 -10 Left 1131974431 15:97929957-97929979 CCAGGCTCAGTAACTGGGTAGGA No data
Right 1131974432 15:97929970-97929992 CTGGGTAGGACTGAAACTGCAGG No data
1131974425_1131974432 14 Left 1131974425 15:97929933-97929955 CCTGATCTAGCCAGCTTTAGATC No data
Right 1131974432 15:97929970-97929992 CTGGGTAGGACTGAAACTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131974432 Original CRISPR CTGGGTAGGACTGAAACTGC AGG Intergenic
No off target data available for this crispr