ID: 1131977494

View in Genome Browser
Species Human (GRCh38)
Location 15:97960975-97960997
Sequence GGCCGGGCACGTGCTGCTGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 249}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131977491_1131977494 -7 Left 1131977491 15:97960959-97960981 CCAGCGGCGAGACAGTGGCCGGG 0: 1
1: 0
2: 0
3: 5
4: 96
Right 1131977494 15:97960975-97960997 GGCCGGGCACGTGCTGCTGGAGG 0: 1
1: 0
2: 3
3: 27
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131977494 Original CRISPR GGCCGGGCACGTGCTGCTGG AGG Exonic