ID: 1131977992

View in Genome Browser
Species Human (GRCh38)
Location 15:97964694-97964716
Sequence GGCTAACTTGGAATACAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 127}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131977992_1131977996 2 Left 1131977992 15:97964694-97964716 CCTTTCTGTATTCCAAGTTAGCC 0: 1
1: 0
2: 0
3: 8
4: 127
Right 1131977996 15:97964719-97964741 CAAGAAACTCTGTGTTAGTCAGG 0: 1
1: 0
2: 1
3: 13
4: 174
1131977992_1131977997 13 Left 1131977992 15:97964694-97964716 CCTTTCTGTATTCCAAGTTAGCC 0: 1
1: 0
2: 0
3: 8
4: 127
Right 1131977997 15:97964730-97964752 GTGTTAGTCAGGAGAGCTCAAGG 0: 1
1: 0
2: 0
3: 10
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131977992 Original CRISPR GGCTAACTTGGAATACAGAA AGG (reversed) Intronic
901174375 1:7288104-7288126 GGATAACTTGAAGTACAGAGAGG + Intronic
902495805 1:16871481-16871503 GGCTGATTTGGAGGACAGAACGG + Intronic
903796554 1:25933321-25933343 GGTTAACTGGGAAAACAGAAAGG - Intergenic
903860935 1:26364157-26364179 GCTTAACTTGGAGTCCAGAAAGG + Intronic
904312608 1:29638985-29639007 TGATAAGTTGGAATAGAGAAGGG + Intergenic
907763521 1:57386065-57386087 GGATAACATGGGAAACAGAATGG + Intronic
909695641 1:78465434-78465456 GGCTCACAAGGAAGACAGAATGG + Intronic
909991487 1:82227877-82227899 GGCTGACTTGGAATTAAGACTGG - Intergenic
910305572 1:85759573-85759595 GGCCAAGAAGGAATACAGAAAGG + Intronic
910461954 1:87457400-87457422 GGATAACTTTAAATAAAGAATGG + Intergenic
912172096 1:107113189-107113211 GGCTAACTTTGTCCACAGAATGG + Intergenic
912299750 1:108502789-108502811 GGCTCTCTTGGCACACAGAATGG - Intergenic
915496247 1:156284703-156284725 GTCTCACTTGGAATGCAGGAGGG + Intronic
915854427 1:159366659-159366681 GGCACCTTTGGAATACAGAAAGG - Intergenic
916651466 1:166838639-166838661 GTCTAACACGGAATACAGTAAGG - Intergenic
916967162 1:169960854-169960876 GACTAACTTGGAAAAAAAAATGG + Intronic
921958506 1:221009789-221009811 TGCTAACTGGGGATACAAAATGG - Intergenic
921978326 1:221227328-221227350 TGCAAACTGGGAATAGAGAAGGG + Intergenic
924769367 1:247065420-247065442 AGAAAACTTGGAAGACAGAAGGG - Intronic
1063816665 10:9783137-9783159 TTCTAACTTGGAAGACTGAATGG - Intergenic
1065959006 10:30718935-30718957 GGCTAACAGGGAATAGGGAAGGG - Intergenic
1068234190 10:54211469-54211491 GTGTAACTTGGAAGACAAAATGG - Intronic
1068405408 10:56582138-56582160 GTCTCACTTGGAATCCAGAAAGG + Intergenic
1071486655 10:86106841-86106863 GGCTAAGATGGGATAGAGAATGG + Intronic
1075189939 10:120297769-120297791 GGCTAACTTGAGAAACAAAAGGG - Intergenic
1076317741 10:129554652-129554674 AGCCAACCTGCAATACAGAAAGG - Intronic
1079296477 11:19239626-19239648 GAACAACTTGGAATTCAGAAAGG - Intronic
1080751178 11:35151859-35151881 GGGTAAATGGGAAGACAGAATGG - Intronic
1086493629 11:87380366-87380388 GGCAAAATTGGAATAGACAATGG + Intergenic
1088250209 11:107855939-107855961 GGCTAATTTTTAATACAGACAGG - Intronic
1089108512 11:116035718-116035740 GGCTAACTAAGAATACTGGAAGG - Intergenic
1090744277 11:129694085-129694107 GGCCCACTTGGGACACAGAATGG + Intergenic
1094754731 12:33454786-33454808 GGCCCTCTTGGTATACAGAACGG - Intergenic
1097057847 12:56260731-56260753 GGCTAACTTTGAGTAGAGATGGG + Intergenic
1105582197 13:21708949-21708971 GGACCACATGGAATACAGAATGG - Intergenic
1114278677 14:21170122-21170144 GGCTCACTTGGAAGAGAGACTGG - Intergenic
1120242078 14:81960966-81960988 GACTAACTTAGAACACAGTAGGG - Intergenic
1120605192 14:86567162-86567184 GTCTAATTTTGAATATAGAATGG + Intergenic
1120899217 14:89561026-89561048 AGATGACTGGGAATACAGAACGG + Intronic
1121949783 14:98161432-98161454 GGCTAAATGGAAAGACAGAATGG - Intergenic
1122520669 14:102341438-102341460 GGCTAACTTAGAAGCCAGGAGGG + Exonic
1125245621 15:37634714-37634736 TGCTAAGTTCCAATACAGAATGG + Intergenic
1128954107 15:71921291-71921313 GGCTAACTTGTTATCCAAAAGGG + Intronic
1131977992 15:97964694-97964716 GGCTAACTTGGAATACAGAAAGG - Intronic
1133610008 16:7424385-7424407 GAGTAGCTGGGAATACAGAAGGG + Intronic
1134754248 16:16652108-16652130 GGCTAACTTTTAATGCACAATGG - Intergenic
1141814048 16:86397390-86397412 TGCTAACTTAGAAAACAAAATGG + Intergenic
1144336607 17:14277050-14277072 AGCTAACTTGGAACTCAGATGGG - Intergenic
1147176392 17:38658678-38658700 GACTGACTTGGAACTCAGAAAGG + Intergenic
1148581966 17:48750318-48750340 GAATTACTTGGAAGACAGAATGG + Intergenic
1159661605 18:71103328-71103350 AGCCACCTTGGAAAACAGAATGG - Intergenic
1161389428 19:4013532-4013554 GGGTAACTTGTAACACAGCAAGG - Intronic
1162306598 19:9878275-9878297 TGCTGACTGGGAACACAGAAAGG + Intronic
1163119003 19:15204924-15204946 AGCAAACTTTGAATACAGACTGG - Intergenic
1163880011 19:19911200-19911222 GGCTAACTCTGAATAGAAAATGG - Intronic
1166689902 19:44816144-44816166 GGCTAACTTTTAGTACAGAGGGG - Intronic
926964819 2:18398290-18398312 GGATAAGTTAGAATACAGACAGG + Intergenic
928238145 2:29563267-29563289 GGTTTACTTGGATTACAGAACGG + Intronic
932072231 2:68632468-68632490 GGCTAACTTGATAGACAAAATGG + Intergenic
935261690 2:101361479-101361501 GGCTGGCTTTGAATACAGAAGGG + Intronic
935426880 2:102928735-102928757 GGCTATTTTGGAATACATACTGG + Intergenic
935809906 2:106787492-106787514 GGGAAACTGGGAAAACAGAAGGG + Intergenic
936064312 2:109319002-109319024 TGCTAACTGGGATTACAGATGGG + Intronic
938718364 2:134042155-134042177 GGCTAACTAAGAAAAAAGAAAGG + Intergenic
939194035 2:138950301-138950323 AGCAAACTTGTAATACAGCAGGG - Intergenic
940689158 2:156893336-156893358 CTCTAACTTGGAAAACAGAGAGG - Intergenic
943025106 2:182617848-182617870 GGCTAACATGTAATCCAGATGGG - Intergenic
945426514 2:209711162-209711184 GACTTTCTTGGAATACTGAAAGG - Intronic
947012074 2:225577488-225577510 GGTTAAGTTGGAATACATTATGG + Intronic
1178273842 21:31218245-31218267 GACTAAGATGGAATAGAGAATGG - Intronic
1178751366 21:35306979-35307001 GGCTAACTTCCAACAAAGAAAGG + Intronic
1181719294 22:24761553-24761575 TGCTGACTTGGGAGACAGAAAGG + Intronic
1185197316 22:49480068-49480090 GGCCAACCTGAAATCCAGAAGGG + Intronic
949431907 3:3985877-3985899 TGCTAACATGGAGTACAGAAAGG + Intronic
952273335 3:31853520-31853542 AGCCACCTTGGAATACAGATTGG + Intronic
953622414 3:44544360-44544382 GGCTGACATGGAATCTAGAAAGG + Intergenic
955260717 3:57387648-57387670 GACTCCCTTGGAATTCAGAATGG + Intronic
955302014 3:57789300-57789322 GGCTCACTCTGAATACAGCATGG + Intronic
956468142 3:69539217-69539239 GGCTAACTTACAATACAAATAGG - Intronic
959431860 3:106264102-106264124 GGATACCGTGGAAGACAGAATGG - Intergenic
960552237 3:118988635-118988657 GGGAAACTTGGAGGACAGAATGG + Intronic
961424220 3:126832326-126832348 GGCTAACTTAGAATAAGAAAAGG - Intronic
963162229 3:142162690-142162712 AACAAACTTGGAAGACAGAAAGG + Intergenic
965797558 3:172457211-172457233 GGCTATCTAGGAAATCAGAAAGG - Intergenic
965971430 3:174561070-174561092 GCTTAACTTTGAATACAGAATGG + Intronic
966450933 3:180060664-180060686 TGCTAAAATGGAATAGAGAAAGG + Intergenic
968435749 4:588096-588118 GACTGACTTGGAAGACAGAACGG + Intergenic
968637458 4:1688488-1688510 GGCTAATTTTGCATACAGACGGG + Intergenic
969066092 4:4482461-4482483 TTCTAACTTGGAATCTAGAAAGG - Intronic
973685377 4:53364925-53364947 GTCTAAAGTGGAATACAGACAGG - Intronic
974048410 4:56916930-56916952 GGCTAATTTGGAAAACAGTTTGG - Intronic
978085128 4:104642614-104642636 TTCTGCCTTGGAATACAGAATGG - Intergenic
978459345 4:108933592-108933614 ATATAACTTGGCATACAGAAAGG - Intronic
978874043 4:113617117-113617139 GACTAACTTGCAATACATAGTGG - Intronic
980578145 4:134712565-134712587 GGCACAATTGGAATACAGACAGG + Intergenic
981835273 4:149045851-149045873 TGCTTGCTGGGAATACAGAATGG + Intergenic
982645822 4:158024211-158024233 GGCTAACTTACAATAAAGACTGG + Intergenic
983996530 4:174189254-174189276 GGCTAAATTTGAAGACATAATGG - Intergenic
983999320 4:174221674-174221696 GGATATCTTGGAAGAAAGAAGGG + Intergenic
986318199 5:6605345-6605367 TGTTAACTCGGACTACAGAAGGG - Exonic
993974748 5:94464967-94464989 GGCTAACTTAGGAGGCAGAATGG + Intronic
996048509 5:118905316-118905338 TGCTAATTAGGAATTCAGAAAGG + Intronic
997064067 5:130542435-130542457 GGATGATTTGGAAAACAGAAAGG - Intergenic
997437737 5:133887207-133887229 GGCTAACTTGGGAGCCAGGATGG - Intergenic
999649577 5:153752146-153752168 GGTTTAATGGGAATACAGAAGGG + Intronic
999710778 5:154316373-154316395 ACCTTACTTGGAAAACAGAAGGG + Intronic
1000878076 5:166665194-166665216 GTCTAACTAGGAAAACAGCAGGG + Intergenic
1001124808 5:169009959-169009981 TGATAACTTGTAAAACAGAAAGG + Intronic
1004704825 6:18114801-18114823 GGTTAATTTGGAATATGGAAAGG + Intergenic
1005013910 6:21359942-21359964 GTCTCACTTGGAAAACAGGATGG - Intergenic
1007307124 6:40915770-40915792 GGCTGACTTGCAGTACAGATGGG - Intergenic
1010456015 6:76056604-76056626 GGCTATTTTGGAAAACAGTATGG - Intronic
1012330607 6:97980730-97980752 GGCTATCAGGGAATACAAAAGGG + Intergenic
1013677600 6:112482990-112483012 TGCTAAATTGGAACACAAAATGG - Intergenic
1026146391 7:67750201-67750223 GGGTAACTGGAACTACAGAATGG + Intergenic
1034700531 7:153091831-153091853 GGCCCACTGCGAATACAGAAAGG + Intergenic
1036271387 8:7306620-7306642 GGCCACCTTGGAAAACAGTATGG + Intergenic
1036349961 8:8003723-8003745 GGCCACCTTGGAAAACAGTATGG - Intergenic
1036845231 8:12164237-12164259 GGCCACCTTGGAAAACAGTATGG - Intergenic
1036866600 8:12406558-12406580 GGCCACCTTGGAAAACAGTATGG - Intergenic
1037998836 8:23373312-23373334 GCCTAACTTTGAATTCAGGAAGG + Intronic
1038416820 8:27402889-27402911 AGATAACTTGGGATACACAATGG - Intronic
1039259058 8:35750794-35750816 GGCTAACCTGAAATGCACAAGGG - Exonic
1045315006 8:101035916-101035938 GTCCAAATTGGAATATAGAAAGG + Intergenic
1045369003 8:101502456-101502478 GGATCACATGGAATTCAGAAGGG + Intronic
1050147254 9:2582511-2582533 GCCTAATTAGGAATACAGGATGG + Intergenic
1050635369 9:7606686-7606708 AGCCCACTTGCAATACAGAAAGG - Intergenic
1051586772 9:18734868-18734890 GGCTTACCTGGAAGACTGAAAGG - Intronic
1055888776 9:81099593-81099615 GGCTATCATGGAAAACAGAATGG - Intergenic
1056469539 9:86892420-86892442 TGCTGACTTAGAAGACAGAAAGG - Intergenic
1060118936 9:120969746-120969768 GGGCCCCTTGGAATACAGAAAGG + Intronic
1187155013 X:16713776-16713798 AGCTAACATGGACAACAGAAGGG + Intergenic
1194250338 X:91567060-91567082 GGGTAAGTTGGGATACAAAAAGG - Intergenic
1196862786 X:120043311-120043333 GTCTTAATTGCAATACAGAAAGG - Intergenic
1196880316 X:120193033-120193055 GTCTTAATTGCAATACAGAAAGG + Intergenic
1200569294 Y:4808305-4808327 GGGTAAGTTGGGATACAAAAAGG - Intergenic